Human tissues
The Shanghai First Maternity and Infant Hospital, Tongji University School of Medicine, Shanghai, China, provided 30 pairs of human cervical cancer and matched adjacent para-cancerous tissues. All cervical cancer patients provided written informed consent. The human cervical cancer and the corresponding adjacent normal tissues (n = 30) were surgically resected from cervival cancer patients in Shanghai First Maternity and Infant Hospital, Tongji University School of Medicine, Shanghai, China. The corresponding adjacent para-cancerous tissues were obtained 5 cm beyond the boundary of the cancerous tissue, which were myometrium in essence. Each samples were divided into two groups, one was harvested and embedded in Tissue-Tek OCT compound (Sakura, Tokyo, Japan) within 10 min after resection from the patients and subsequently snap-frozen in liquid nitrogen before storage at − 80 °C, while another one was fixed in fresh 10% neutral-buffered formal in for 24 h at room temperature.
Cells culture
All cell lines used in the present study were purchased from the cell bank of the Shanghai Biology Institute (Shanghai, China), including normal cervical epithelial cells HcerEpic and the human cervical cancer cell lines, including Hela, C-33A, Caski, and SiHa. Cells were cultured in RPMI-1640 medium (SH30809.01B, Hyclone, USA) containing 10% foetal bovine serum (16000–044, Gibco, USA) and 1% penicillin-streptomycin (P1400–100, Solarbio, China) and maintained in a 37 °C incubator with 5% CO2. The AKT inhibitor LY294002 (25 μmol/L; S1105, Selleck, USA) was dissolved in dimethyl sulfoxide (DMSO, D2650, Sigma, USA) and used to treat the cells.
Overexpression and knockdown of USP18
Briefly, the full-length USP18 (NM_017414.4) coding region sequence (CDS) was inserted into the lentiviral-mediator vector (pLVX-Puro). Then, the recombinant vector was transfected into human Hela cells using Lipofectamine 2000, following the manufacturer’s protocols (Cat: 11668027, ThermoFisher, USA) (oeUSP18). A mock vector was transfected as corresponding control (oeNC).
For silencing, three small interference RNAs (siRNAs), targeting different regions of the human USP18 gene, were synthesised [siUSP18–1 (347–365): CCTGCTGCCTTAACTCCTT; siUSP18–2 (1004–1022): GCCAGATCCTTCC AATGAA; and siUSP18–3 (1023–1041): GCGAGAGTCTTGTGATGCT] and then transfected into Caski and SiHa cells. A nonspecific scrambled siRNA was transfected as corresponding control siNC (5′-CAACATTGGACAGACCTG CTGCCTT-3′).
Cell proliferation
Cell proliferation was determined by using the Cell Counting Kit-8 (CCK-8) (CP002, SAB, USA) following the manufacturer’s instructions. The OD450 value was quantified using a microplate reader (DNM-9602, Pulangxin, China). Three replications were analysed for each time point.
Flow cytometry
Briefly, the cell (Hela, Caski, and SiHa) were stained using an Annexin V-fluorescein isothiocyanate (FITC) apoptosis detection kit (Beyotime, China) according to the manufacturer’s instructions, at 48 h after transfection. Then, the proportion of apoptotic cells were determined using flow cytometer (BD, USA). Three replicates were necessary for each samples.
Real-time PCR
The total RNA from cell samples was extracted using the TRIzol Reagent (1596–026, Invitrogen, USA). Then, the cDNA synthesis kit (Fermentas, Canada) was used to reverse transcribe the RNA into complementary DNA (cDNA) according to the manufacturer’s instructions. GAPDH expression was functioned as internal reference and used to normalise gene expression. Gene expressions were determined using the 2-ΔΔCt method [11]. Three biological replicates were included for each analysis. The primers that used in this research were listed as follows: USP18 F 5′ TCTGGAG GGCAGTATGAG 3′, USP18 R 5′ TGGTAGTTAGGATTTCCGTAG 3′; and GAPDH F 5′ GGATTGTCTGGCAGTAGCC 3′, GAPDH R 5’ATTGT GAAAGGCAGGGAG 3′.
Western blot
Total protein was extracted using RIPA lysis buffer (JRDUN, Shanghai, China). A BCA protein assay kit (PICPI23223, Thermo Fisher, USA) was used to measure total protein concentrations. Equal amounts of proteins adjusted to 25 μg were separated by 10% SDS-PAGE and subsequently transferred onto PVDF nitrocellulose membranes (HATF00010, Millipore, USA) for 12 h. After that, the membranes were then probed with primary antibodies at 4 °C overnight, followed by the appropriate HRP-conjugated goat anti-rabbit IgG (A0208, Beyotime, China) at 37 °C for 60 min. Protein signals were detected using a chemiluminescence system (5200, Tanon, China). GAPDH served as an endogenous reference. The protein expression was quantified as Gene grey value/GAPDH grey value. Each analysis was performed in triplicate. The primary antibodies that used the current study were listed as follows: USP18 (AB168478, Abcam, UK), cleaved caspase-3 (AB32042, Abcam, UK), AKT (#4691, CST, Danvers, USA), p-AKT (#4060, CST, Danvers, USA), Ki-67 (ab92742, Abcam, UK), Cyclin D1 (ab16663, Abcam, UK), Cleaved PARP (ab32064, Abcam, UK), Bax (ab32503, Abcam, UK), β-catenin (ab32572, Abcam, UK) and GAPDH (#5174, CST, Danvers, USA). Primary antibodies were detected using HRP-conjugated anti-rabbit IgG (A0208, Beyotime, Shanghai, China) or anti-mouse IgG (A0216, Beyotime, Shanghai, China) secondary antibodies.
Immunohistochemistry
This assay was performed according to a previous reference [12]. In brief, The tissue sections were fixed in methanol (4%) for 30 min. Then, endogenous peroxidase activity was blocked by incubating with H2O2 (3%) for 10 min. The tissue sections were then incubated with the USP18 primary antibody (ab115618, Abcam, UK) at room temperature for 1 h, followed by the HRP-labelled secondary antibody for 30 min. Then, the sections were stained with DAB and re-stained with haematoxylin for 3 min. An upright microscope (ECLIPSE Ni, NIKON, Japan) was utilised to obtain images, which were analysed using the microscope image analysis system (DS-Ri2, NIKON, Japan) at a magnification of 200 × .
Gene set enrichment analysis (GSEA)
The data were used to generate an ordered list of all genes according to their correlation with USP18 expression, and then a predefined gene set was given an enrichment score and P value. GSEA was performed using The Cancer Genome Atlas (TCGA) cervical cancer dataset with GSEA version 2.0.
Xenograft model
All in vivo experiments were performed according to the Institute’s guidelines for animal experiments and approved by the independent ethics committee of Shanghai First Maternity and Infant Hospital, Tongji University School of Medicine, Shanghai, China.
All animals were treated in accordance with the Institutional Animal Care and Use Committee. An equal number of siNC or siUSP18 transfected Caski cells (n = 5 × 106) were injected subcutaneously into the right flank of 4–6-week-old nude mice (n = 5 for each group; Shanghai Laboratory Animal Company, China). The length and width of the tumours were determined every 3 days for 33 days after cell injections. The volumes of the tumours were calculated according to the formula as follows: length × (width2/2). Then, both siNC and siTRIM37-injected mice were sacrificed by cervical dislocation, and then the tumour tissues were surgically removed and fixed in 4% formalin for further analysis.
TUNEL staining
TUNEL assays were performed with sections using an ApopTag kit (Intergene) according to the supplier’s instructions. Three replicates were analysed for each sample.
Statistical analysis
Statistical analyses were performed using GraphPad Prism software Version 7.0 (CA, USA). All data were presented as the mean ± S.E.M from three independent experiments. Statistical significance was assessed using Student’s t-test and one-way analysis of variance. A p value < 0.05 was considered to indicate statistical significance.
