Somatic mutations in the mitochondrial genome occur in numerous tumor types including brain tumors. These mutations are generally found in the hypervariable regions I and II of the displacement loop and unlikely alter mitochondrial function. Two hypervariable regions of mononucleotide repeats occur in the mouse mitochondrial genome, i.e., the origin of replication of the light strand (OL) and the Arg tRNA.
Methods
In this study we examined the entire mitochondrial genome in a series of chemically induced brain tumors in the C57BL/6J strain and spontaneous brain tumors in the VM mouse strain. The tumor mtDNA was compared to that of mtDNA in brain mitochondrial populations from the corresponding syngeneic mouse host strain.
Results
Direct sequencing revealed a few homoplasmic base pair insertions, deletions, and substitutions in the tumor cells mainly in regions of mononucleotide repeats. A heteroplasmic mutation in the 16srRNA gene was detected in a spontaneous metastatic VM brain tumor.
Conclusion
None of the mutations were considered pathogenic, indicating that mtDNA somatic mutations do not likely contribute to the initiation or progression of these diverse mouse brain tumors.
Background
Mitochondrial DNA (mtDNA) is essential for the production of subunits for the electron transport chain, since it encodes peptides for Complex I, III, IV, and V. The mitochondrial genome consists of a 16.5 kb piece of circular DNA encoding 37 genes on the L and H strands. These include 22 tRNAs, 2 rRNAs, and 13 respiratory chain subunits [1]. The mitochondrial genetic code varies slightly from the nuclear genetic code and the mutation rate of the mitochondrial genome is 10 fold higher than that of the nuclear genome [2–4]. This higher mutation rate may be due in part to a lack of protective histones, reduced fidelity of polymerase γ, or to the localization of the mitochondrial genome to the inner mitochondrial membrane near damaging reactive oxygen species [5–9]. mtDNA mutations may also contribute to a decrease in metabolic efficiency that enhances aging, promotes neurodegeneration, and is conducive to carcinogenesis [10–12].
mtDNA mutations have been studied in various types of cancers, including breast [13], bladder, lung, head and neck [14], gastric [15], esophageal [16], pancreatic [17], and colon [18]. The majority of the mutations in the mitochondrial genome of human tumors were found in the hypervariable regions of the displacement loop (D-loop) [19–21]. Alterations in these hypervariable regions are unlikely to alter mitochondrial function or produce a diseased phenotype [22]. These hypervariable regions correspond to the OL and Arg tRNA in mouse mtDNA [23]. Otto Warburg originally emphasized that the high glycolytic rate of tumors resulted from diminished or disturbed respiration [24, 25]. Recent studies suggest that mtDNA mutations may contribute to the respiratory defects in cancer [18]. Furthermore, studies of human tumors have demonstrated an association between mtDNA somatic mutations and tumor progression [26–28].
Few studies have evaluated mtDNA mutations in brain cancer. Mitochondrial genome instability was found in the hypervariable regions in the D-loop of human gliomas, meningiomas, schwannomas, gliomatosis cerebri, glioblastomas, astrocytomas, and neurofibromas [29–33]. Other studies of the mitochondrial genome focused on mtDNA copy number in brain tumors [34]. In the only study examining the entire mitochondrial genome, Wong et al. found that the majority of mtDNA somatic mutations in medulloblastomas existed in regions of mononucleotide repeats, rather than in genes encoding proteins for the respiratory chain complexes [35]. A recent study in mouse tumorigenic fibroblasts, suggest that nuclear mutations rather than mtDNA mutations contribute to the tumor phenotype [36]. It is not yet clear if mtDNA mutations contribute to brain tumor progression.
In contrast to most tissues where mitochondrial morphology and function is relatively homogeneous, mitochondria in brain are heterogeneous and exist as non-synaptic free mitochondria (FM), synaptic light mitochondria (LM), and synaptic heavy mitochondria (HM) [37, 38]. This morphological heterogeneity is thought to reflect the metabolic heterogeneity of mitochondria within and between the various neuronal and non-neuronal (glial) cell populations [39]. Besides morphological heterogeneity, genetic heterogeneity in mtDNA has been reported in normal human brain tissue [40]. In this study, we sequenced the entire mitochondrial genome in a series of chemically induced and spontaneous mouse brain tumors that differ in metastasis, malignancy, and vascularity. To our knowledge, no prior studies have compared the sequence of the entire mitochondrial genome in brain tumor cell lines with that of the syngeneic brain tissue. Although we found several mutations, none of these were considered pathogenic.
Methods
Mice and brain tumors
The inbred VM and C57BL/6J (B6) mouse strains were obtained originally from Professor H Fraser, University of Edinburgh, and from the Jackson Laboratory, Bar Harbor, ME, respectively. All mice used in the study were propagated in the animal care facility at Boston College using animal husbandry conditions described previously [41]. All animal-use procedures were in accordance with the NIH Guide for the Care and Use of Laboratory Animals and were approved by the Institutional Animal Care Committee.
The EPEN and CT-2A brain tumors were produced originally from implantation of 20-methylcholanthrene into the brains of B6 mice as previously described [42, 43]. The EPEN tumor arose in the cerebral ventricle and was characterized as an ependymoblastoma, whereas the CT-2A tumor arose in the cerebral cortex and was characterized as a poorly differentiated astrocytoma [42, 44]. The CT-2A tumor contains complex gangliosides, is highly angiogenic in vivo, and grows in vitro as a fusiform monolayer [42, 45, 46]. In contrast, the EPEN tumor expresses only the simple ganglioside GM3, is less angiogenic in vivo, and grows in vitro as cuboidal cell islands [41, 42, 46–49]. The nonmetastatic (VM-NM) and the metastatic (VM-M) tumors arose spontaneously in the brains of VM mice as previously described for other VM brain tumors [50, 51].
Tumor cell culture
Cultured cell lines were prepared from each tumor as we previously described [52, 53]. The number of passages for CT-2A and EPEN cell lines were greater than 40, where as VM-NM and VM-M were passaged 9 and 11 times, respectively. The VM-M cell line maintained metastatic capacity when implanted into VM mice. The tumor cells were grown in Dulbecco's modified Eagle medium (DMEM) supplemented with 10% heat-inactivated fetal bovine serum (FBS) in a humidified atmosphere containing 95% air and 5% CO2 at 37°C. Upon reaching confluency, the cells were trypsinized and collected.
Mitochondrial isolation from brain tissue and cultured tumor cells
Mitochondria were isolated from VM and B6 cerebral cortex according to previously described procedures [38, 54]. Cerebral cortex mitochondria were separated into three populations following ficoll gradient centrifugation. These populations included non-synaptic free mitochondria (FM), synaptic light mitochondria (LM), and synaptic heavy mitochondria (HM). Mitochondria were isolated from the tumor cell lines as a single enriched mitochondrial fraction as previously described [54, 55]. Mitochondria were isolated in duplicate independent samples from each of the brain tumor cell lines for sequence comparison.
Isolation and amplification of mouse mtDNA
mtDNA from cerebral cortex and cultured tumor cells was isolated using the DNeasy Tissue Kit (QIAGEN, Valencia, CA, USA) and was amplified in 12 overlapping segments covering the entire mitochondrial genome. PCR reactions were performed in a volume of 50 μl using the Eppendorf Master Taq system (Brinkmann Eppendorf, Westbury, NY). Primers used for mtDNA amplification are given in Table 1. PCR conditions for all primer pairs consisted of an initial denaturation at 94°C for 120 s followed by 34 cycles of 94°C for 60 s, an annealing temperature of 57–66°C for 35 s and 72°C for extension at 105 s. A final extension was for 5 min. Optimal annealing temperatures were determined by performing gradient PCR on each of the primer sets.
Table 1
Primers used for amplification of Mus Musculus mitochondrial genome
Primer pair
mtDNA bp
Forward primer
Reverse primer
1
15309-00040
GGTCTTGTAAACCTGAAATGAAG
GCATTTTCAGTGCTTTGCTTTG
2
16173-01436
CTGATCAATTCTAGTAGTTCC
CAAGCTCGTTAGGCTTTTCAC
3
01314–02880
GAATTACAGCTAGAAACCCCG
CGTATGGACCAACAATGTTAGG
4
02673–03873
GTTATTAGGGTGGCAGAGCCAG
GCCCGATAGCTTAATTAGCTGAC
5
03731–05324
CTTTGATAGAGTAAATTATAGAGG
TAAAATGGCTGAGTAAGCATTAG
6
05194–06593
GTCTTAGTAGAGATTTCTCTACAC
GTTTACTCCTACGAATATGATGG
7
06477–07996
GGAGCAGTGTTTGCTATCATAGC
TGATGGCTACAACGATTGGGAATC
8
07847–09438
GTCTCATCACAAACATTCCCAC
CAGAATCTACTAATTGGAAGTCAG
9
09307–10806
GATTTGAAGCCGCAGCATGATAC
GTCATAGGTGAACTCCATATAATGG
10
10647–12399
GCCCTCATCTTAATCCAAAACC
CTGTAGCTGCGATTAATAGGC
11
12247–13788
CAATCCTCTATAACCGCATCG
GTATTGGGGGTGATTATAGAG
12
13670–15498
CCAACATCATCAACCTCATAC
GTACTAGCTTATATGCTTGGG
The nucleotide positions were based on Mus Musculus sequence from Bibb et al. 1981 [GenBank: V00711]
mtDNA sequencing
Amplified regions of mtDNA were purified using a PCR purification kit (MO BIO Laboratories, Solana Beach, CA) and were then visualized by 1% agarose gel electrophoresis. DNA concentration was estimated using a Low DNA Mass Ladder (Invitrogen, Carlsbad, CA) by gel electrophoresis. Approximately 25 fmol of the purified PCR product was used in the sequencing reaction following manufacturer's instructions for the CEQ DTCS kit (Beckman Coulter, Fullerton, CA). The amount of DNA used varied depending on the size of the PCR fragment. The primers in Table 1, together with 75 nested primers, were used in the sequencing reactions to obtain double-stranded sequence. Nested primer information can be made available upon request to corresponding investigators.
Sequencing reactions were performed at 96°C for 20 s, 50°C for 20 s, and 60°C for 240 s based on a 32 cycle reaction. Sequencing products were ethanol precipitated in cold 95% ethanol, washed twice with cold 70% ethanol, dried for 20 minutes, and then re-dissolved in sample loading solution provided by the manufacturer (Beckman Coulter, Fullerton, CA). The mtDNA sequence alignments were then compared to those from Mus Musculus [GenBank: V00711] [56] and from B6 mice [GenBank: AY172335] [23].
Results
Analysis of mtDNA variation in B6 and VM mouse strains
Sequence analysis of the entire mitochondrial genome of the VM and B6 mouse strains revealed a single nucleotide base pair change at position 11780, found in both strains, compared to the republished B6 sequence [23]. This resulted in a T->A transversion, causing an amino acid change of an isoleucine to methionine in the ND5 gene (Table 2). This transversion was found in all three brain mitochondrial populations for both strains and existed in all brain tumor cell lines corresponding to the host strain. This was the only variation found between the B6 strain sequence and the republished B6 sequence [23]. The VM strain also had two additional nucleotide variations compared to the B6 strain. The first variation was found in the ND3 gene at position 9461. This caused a T->C transition, but resulted in no amino acid change. A second variation existed in the poly-A tract of the Arg tRNA, where an adenine was inserted at position 9829 (Table 2). The data show that few mtDNA variations exist between the B6 and VM inbred mouse strains.
Table 2
Summary of mtDNA nucleotide variations in C57BL/6J and VM mouse strainsa
Mouse strain
Nucleotide position
Gene
DNA change
Amino acid change
C57BL/6J
11780
ND5
T->A
Ile->Met
VM
11780
ND5
T->A
Ile->Met
VM
9829
Arg tRNA
InsA
NAb
VM
9461
ND3
T->C
Ile->Ile
Accession numbers for C57BL/6J and VM strains are DQ106412 and DQ106413, respectively
a Nucleotide variation compared to the republished C57BL/6J mtDNA sequence from Bayona-Bafaluy et al. 2003
b NA, not applicable
mtDNA somatic mutations in mouse brain tumor cell lines compared to syngeneic host mtDNA sequence
Analysis of the EPEN brain tumor cell line revealed two somatic mutations compared to the syngeneic B6 host strain. One mutation involved an insertion of two adenines in the Arg tRNA at position 9829 (Table 3). This is not expected to alter Arg tRNA function because the mutation occurred in a highly variable site in mouse strains [23]. A second mutation involved a T->C transition in the ND3 gene at position 9461, but did not change the amino acid. Analysis of the CT-2A brain tumor cell line revealed only a single mutation compared to the syngeneic B6 host strain. This involved an insertion of an adenine in the OL at position 5182 (Table 3). This mutation is also not likely to have functional consequence [23].
Table 3
Summary of mtDNA mutations in experimental mouse brain tumor cell linesa
Brain tumor cell line
Metastatic
Host genetic background
Nucleotide position
Gene
DNA change
Stateb
Amino acid change
EPEN
-
B6
9829
Arg tRNA
InsAA
Homo
NAc
9461
ND3
T->C
Homo
Ile->Ile
CT-2A
-
B6
5182
OL
InsA
Homo
NA
VM-NM
-
VM
5182
OL
DelA
Homo
NA
15584
D-loop
T->C
Homo
NA
VM-M
+
VM
2159
16srRNA
A->G
Hetero
NA
a Tumor cell lines mtDNA sequences were compared to host strain brain mtDNA populations
b Homo, homoplasmy; hetero, heteroplasmy
c NA, not applicable
As in the chemically induced EPEN and CT-2A brain tumor cell lines, only a few somatic mutations were found in the VM brain tumor cell lines (VM-NM and VM-M) compared to the syngeneic VM host (Table 3). Two somatic mutations were found in the nonmetastatic VM-NM cell line. The first mutation involved a deletion of an adenine in the OL at position 5182. This is the same location where the only variation was found in the CT-2A tumor and is consistent with hypervariability in this region [23]. The second mutation in this cell line involved a T->C transition in the D-loop at position 15584. Neither of these mutations have functional consequence.
A single mutation was found in the metastatic VM-M cell line involving an A->G transition in the 16srRNA gene at position 2159. In contrast to the other mtDNA mutations found in either the B6 or the VM tumor cell lines, the A->G transition in the VM-M cell line was heteroplasmic (Figure 1). This heteroplasmic mutation, however, was not found in another independently derived cell line from this metastatic tumor. Viewed together, these data indicate that only a few mtDNA somatic mutations exist in the chemically induced tumors in the B6 mice or in the spontaneous brain tumors in VM mice. Also, most of these mutations were found in hypervariable regions and none are considered pathogenic.
Figure 1
Heteroplasmy in the metastatic VM-M tumor cell line. Mitochondrial 16srRNA revealed a heteroplasmic mutation at position 2159 of an A to G transition. The three VM brain mitochondrial populations (LM, HM, and FM) displayed the same chromotagraph profile. The same level of heteroplasmy was observed in duplicate independent samples for the VM-M cell line. Arrow indicates heteroplasmic nucleotide at position 2159 compared to control.
Discussion
The purpose of this study was to determine if mtDNA mutations existed in chemically induced and spontaneous mouse brain tumors and whether such mutations might provide insight on the development or progression of these experimental brain tumors. To reduce the probability of detecting spurious pathogenic mutations, we compared the mtDNA sequence of each brain tumor cell line with that of normal mtDNA from the syngeneic mouse host strains. Furthermore, to avoid the coamplification of mitochondrial pseudogenes that exist in nuclear DNA, we amplified only large mtDNA fragments (1–1.8 kb in length) in isolated mitochondria [18, 57, 58]. Because the solid tumors become infiltrated with host stromal cells containing wildtype mitochondria [59], we used cultured tumor cell lines for these studies instead of whole tumor tissue. Hence, our experimental design will detect any mtDNA mutation that could alter mitochondrial function.
Several mtDNA mutations were found in the mouse brain tumor cell lines, but most of these were located in hypervariable mononucleotide hotspot regions, such as in the OL and in the Arg tRNA for mouse mtDNA. Moreover, none of these mutations were considered pathogenic since they did not change amino acid sequence and therefore could not alter gene function. Tumor cells in each line were selected from original tumors that may have contained multiple transformed cell types. The lines therefore represent only those cells with the most aggressive malignant growth in vitro and in vivo. The absence of pathogenic mutations in these tumor cells, further suggests that mtDNA mutations do not likely contribute to the initiation or the progression of these diverse mouse brain tumors.
Most tumors including brain tumors express abnormalities in the number and function of their mitochondria [60, 61]. Warburg originally emphasized that the high glycolytic rate of tumors results from diminished or disturbed respiration [24, 25]. Later studies in a variety of neural and non-neural tumor systems showed that these respiratory disturbances could involve abnormalities in TCA cycle components, alterations in electron transport, and deficiencies in oxidative phosphorylation [62–66]. Recent studies also suggest that mtDNA mutations may contribute to the respiratory defects in cancer [18]. Our findings indicate that diminished respiration and the glycolytic dependence of the chemically induced CT-2A and EPEN brain tumors or the two spontaneous VM brain tumors studied here do not result from somatic mutations in their mtDNA.
In contrast to previous reports of genetic heterogeneity in normal human brain mtDNA, [40, 67] we found no evidence for genetic heterogeneity in mtDNA isolated from synaptic and nonsynaptic mitochondria in the C57BL/6J and VM mouse strains by direct sequencing. On the other hand, our findings that most mtDNA changes in the mouse brain tumors were in hypervariable regions of mononucleotide repeats are in general agreement with previous studies in human brain tumors (Table 4). We detected a single heteroplasmic mutation in the 16srRNA gene of the VM-M metastatic cell line, which was determined by sequence analysis [68]. Since this heteroplasmic mutation was not detected in another independently derived cell line from this tumor, it is unlikely that the mutation is associated with either tumorigenesis or metastasis. The EPEN cell line contained a nucleotide variation compared to the B6 genotype at position 9461 in the ND3 gene. This nucleotide variation in the EPEN cell line also was found in the VM-NM and VM-M cell lines. This polymorphism could be due to a base pair wobble at that location or could result from a nucleotide variation in the original C57BL/6J mouse from which the EPEN tumor arose [44].
Table 4
mtDNA alterations in human brain tumors compared to matched tissue controls
Type of tumor
Number of tumors
Number of tumors with mtDNA somatic mutationsa
Number of somatic mutations causing amino acid substitutionsc
Region of mutation
Reference
Neurofibroma
37
23/37
NAd
D-loop
Kurtz et al. 2004
Glioma
53
20/53
NA
HVRII
Vega et al. 2004
Meningioma
11
5/11
NA
Schwannoma
5
1/5
NA
Medulloblastoma
15
6/15
2/18
D-loop, Asp tRNA, COXI, CoxII, Thr tRNA, ND4
Wong et al. 2003
Gliomatosis cerebri
6
2/6
NA
HVRII
Kirches et al. 2003
Glioma
55
12/55
NA
HVRII, D-loop
Kirches et al. 2001
Astrocytoma
12
11/12b
NA
HVRII
Kirches et al. 1999
a Number of tumors with mutations/number of tumors
b 2 of the 12 astrocytomas were compared to adjacent brain, the remaining 10 were aligned to Anderson et al. 1981 for mutation analysis
c Number of mutations causing amino acid substitutions/total number of mutations found in all tumors
d NA, not applicable because in hypervariable region of the D-loop (HVR)
The four mouse brain tumor cell lines we examined represent both spontaneous and chemically induced tumors that differ in cell origin, biochemical composition, and angiogenesis. The selection of the cell lines provides a comparison for defining the contribution that mtDNA might play in carcinogenesis. Although we did not find any mtDNA pathogenic mutations in these brain tumors, we do not rule out the possibility that such mutations might occur in other spontaneous mouse brain tumors or in mouse brain tumors induced with other chemical carcinogens. Our findings suggest that mtDNA mutations do not likely contribute to the development or progression of CT-2A or EPEN chemically induced tumors or the metastatic and nonmetastatic spontaneous VM brain tumors.
With the exception of a single variation at nucleotide 11780 in the ND5 gene, our whole mitochondrial genome sequence for the B6 strain was in complete agreement with the recently republished sequence for this mouse strain [23]. This single nucleotide difference involved a T->A transversion that changed isoleucine to methionine. This difference was also found in the VM mouse strain as well as in all examined mouse brain tumor cell lines. It is not yet clear if this variation represents an error in the republished B6 mtDNA sequence or a population genetic variation among B6 mouse strains. Brain mitochondria were fractionated into different populations for genotyping to confirm that there was no mtDNA heterogeneity in hypervariable regions that might be associated with metabolic heterogeneity. Sequencing of all three brain populations also served as an internal control for the genotype of the mouse strains.
In summary, our results show that the mitochondrial genome of these mouse brain tumor cell lines contain mutations in regions of mononucleotide repeats. These mtDNA mutations in the mouse brain tumors are similar to those found previously in hypervariable regions of the D-loop in human brain tumors. However, none of the mouse mutations were pathogenic suggesting that mtDNA changes do not contribute to the carcinogenic progression of these chemically induced and spontaneous mouse brain tumors.
List of abbreviations
The abbreviations used are:
OL, origin of replication of the light strand
mtDNA:
mitochondrial DNA
kb:
kilobase
D-loop:
displacement loop
B6:
C57BL/6J
Declarations
Acknowledgements
We would like to thank Laura Abate and Kristen Gorham for technical assistance. This work was supported from NIH grants HD39722 and CA102135, a grant from the American Institute of Cancer Research and the Boston College Research Expense Fund.
Authors’ Affiliations
(1)
Department of Biology, Boston College
References
Wolstenholme DR: Animal mitochondrial DNA: structure and evolution. Int Rev Cytol. 1992, 141: 173-216.View ArticlePubMedGoogle Scholar
Barrell BG, Bankier AT, Drouin J: A different genetic code in human mitochondria. Nature. 1979, 282: 189-194. 10.1038/282189a0.View ArticlePubMedGoogle Scholar
Neckelmann N, Li K, Wade RP, Shuster R, Wallace DC: cDNA sequence of a human skeletal muscle ADP/ATP translocator: lack of a leader peptide, divergence from a fibroblast translocator cDNA, and coevolution with mitochondrial DNA genes. Proc Natl Acad Sci U S A. 1987, 84: 7580-7584.View ArticlePubMedPubMed CentralGoogle Scholar
Wallace DC, Ye JH, Neckelmann SN, Singh G, Webster KA, Greenberg BD: Sequence analysis of cDNAs for the human and bovine ATP synthase beta subunit: mitochondrial DNA genes sustain seventeen times more mutations. Curr Genet. 1987, 12: 81-90. 10.1007/BF00434661.View ArticlePubMedGoogle Scholar
Backer JM, Weinstein IB: Mitochondrial DNA is a major cellular target for a dihydrodiol-epoxide derivative of benzo[a]pyrene. Science. 1980, 209: 297-299.View ArticlePubMedGoogle Scholar
Allen JA, Coombs MM: Covalent binding of polycyclic aromatic compounds to mitochondrial and nuclear DNA. Nature. 1980, 287: 244-245. 10.1038/287244a0.View ArticlePubMedGoogle Scholar
Croteau DL, Bohr VA: Repair of oxidative damage to nuclear and mitochondrial DNA in mammalian cells. J Biol Chem. 1997, 272: 25409-25412. 10.1074/jbc.272.41.25409.View ArticlePubMedGoogle Scholar
Bianchi NO, Bianchi MS, Richard SM: Mitochondrial genome instability in human cancers. Mutat Res. 2001, 488: 9-23. 10.1016/S1383-5742(00)00063-6.View ArticlePubMedGoogle Scholar
Cavalli LR, Liang BC: Mutagenesis, tumorigenicity, and apoptosis: are the mitochondria involved?. Mutat Res. 1998, 398: 19-26.View ArticlePubMedGoogle Scholar
Tan DJ, Bai RK, Wong LJ: Comprehensive scanning of somatic mitochondrial DNA mutations in breast cancer. Cancer Res. 2002, 62: 972-976.PubMedGoogle Scholar
Fliss MS, Usadel H, Caballero OL, Wu L, Buta MR, Eleff SM, Jen J, Sidransky D: Facile detection of mitochondrial DNA mutations in tumors and bodily fluids. Science. 2000, 287: 2017-2019. 10.1126/science.287.5460.2017.View ArticlePubMedGoogle Scholar
Maximo V, Soares P, Seruca R, Rocha AS, Castro P, Sobrinho-Simoes M: Microsatellite instability, mitochondrial DNA large deletions, and mitochondrial DNA mutations in gastric carcinoma. Genes Chromosomes Cancer. 2001, 32: 136-143. 10.1002/gcc.1175.View ArticlePubMedGoogle Scholar
Hibi K, Nakayama H, Yamazaki T, Takase T, Taguchi M, Kasai Y, Ito K, Akiyama S, Nakao A: Mitochondrial DNA alteration in esophageal cancer. Int J Cancer. 2001, 92: 319-321. 10.1002/ijc.1204.View ArticlePubMedGoogle Scholar
Jones JB, Song JJ, Hempen PM, Parmigiani G, Hruban RH, Kern SE: Detection of mitochondrial DNA mutations in pancreatic cancer offers a "mass"-ive advantage over detection of nuclear DNA mutations. Cancer Res. 2001, 61: 1299-1304.PubMedGoogle Scholar
Polyak K, Li Y, Zhu H, Lengauer C, Willson JK, Markowitz SD, Trush MA, Kinzler KW, Vogelstein B: Somatic mutations of the mitochondrial genome in human colorectal tumours. Nat Genet. 1998, 20: 291-293. 10.1038/3108.View ArticlePubMedGoogle Scholar
Okochi O, Hibi K, Uemura T, Inoue S, Takeda S, Kaneko T, Nakao A: Detection of mitochondrial DNA alterations in the serum of hepatocellular carcinoma patients. Clin Cancer Res. 2002, 8: 2875-2878.PubMedGoogle Scholar
Ha PK, Tong BC, Westra WH, Sanchez-Cespedes M, Parrella P, Zahurak M, Sidransky D, Califano JA: Mitochondrial C-tract alteration in premalignant lesions of the head and neck: a marker for progression and clonal proliferation. Clin Cancer Res. 2002, 8: 2260-2265.PubMedGoogle Scholar
Kumimoto H, Yamane Y, Nishimoto Y, Fukami H, Shinoda M, Hatooka S, Ishizaki K: Frequent somatic mutations of mitochondrial DNA in esophageal squamous cell carcinoma. Int J Cancer. 2004, 108: 228-231. 10.1002/ijc.11564.View ArticlePubMedGoogle Scholar
Sanchez-Cespedes M, Parrella P, Nomoto S, Cohen D, Xiao Y, Esteller M, Jeronimo C, Jordan RC, Nicol T, Koch WM, Schoenberg M, Mazzarelli P, Fazio VM, Sidransky D: Identification of a mononucleotide repeat as a major target for mitochondrial DNA alterations in human tumors. Cancer Res. 2001, 61: 7015-7019.PubMedGoogle Scholar
Bayona-Bafaluy MP, Acin-Perez R, Mullikin JC, Park JS, Moreno-Loshuertos R, Hu P, Perez-Martos A, Fernandez-Silva P, Bai Y, Enriquez JA: Revisiting the mouse mitochondrial DNA sequence. Nucleic Acids Res. 2003, 31: 5349-5355. 10.1093/nar/gkg739.View ArticlePubMedPubMed CentralGoogle Scholar
Warburg O: The Metabolism of Tumours. 1931, New York, Richard R. Smith Inc., 327-Google Scholar
Shay JW, Werbin H: Are mitochondrial DNA mutations involved in the carcinogenic process?. Mutat Res. 1987, 186: 149-160.View ArticlePubMedGoogle Scholar
Baggetto LG: Role of mitochondria in carcinogenesis. Eur J Cancer. 1992, 29A: 156-159.PubMedGoogle Scholar
Cavalli LR, Varella-Garcia M, Liang BC: Diminished tumorigenic phenotype after depletion of mitochondrial DNA. Cell Growth Differ. 1997, 8: 1189-1198.PubMedGoogle Scholar
Kirches E, Michael M, Woy C, Schneider T, Warich-Kirches M, Schneider-Stock R, Winkler K, Wittig H, Dietzmann K: Loss of heteroplasmy in the displacement loop of brain mitochondrial DNA in astrocytic tumors. Genes Chromosomes Cancer. 1999, 26: 80-83. 10.1002/(SICI)1098-2264(199909)26:1<80::AID-GCC11>3.0.CO;2-4.View ArticlePubMedGoogle Scholar
Kirches E, Krause G, Warich-Kirches M, Weis S, Schneider T, Meyer-Puttlitz B, Mawrin C, Dietzmann K: High frequency of mitochondrial DNA mutations in glioblastoma multiforme identified by direct sequence comparison to blood samples. Int J Cancer. 2001, 93: 534-538. 10.1002/ijc.1375.View ArticlePubMedGoogle Scholar
Kirches E, Mawrin C, Schneider-Stock R, Krause G, Scherlach C, Dietzmann K: Mitochondrial DNA as a clonal tumor cell marker: gliomatosis cerebri. J Neurooncol. 2003, 61: 1-5. 10.1023/A:1021296212233.View ArticlePubMedGoogle Scholar
Vega A, Salas A, Gamborino E, Sobrido MJ, Macaulay V, Carracedo A: mtDNA mutations in tumors of the central nervous system reflect the neutral evolution of mtDNA in populations. Oncogene. 2004, 23: 1314-1320. 10.1038/sj.onc.1207214.View ArticlePubMedGoogle Scholar
Kurtz A, Lueth M, Kluwe L, Zhang T, Foster R, Mautner VF, Hartmann M, Tan DJ, Martuza RL, Friedrich RE, Driever PH, Wong LJ: Somatic mitochondrial DNA mutations in neurofibromatosis type 1-associated tumors. Mol Cancer Res. 2004, 2: 433-441.PubMedGoogle Scholar
Liang BC, Hays L: Mitochondrial DNA copy number changes in human gliomas. Cancer Lett. 1996, 105: 167-173. 10.1016/0304-3835(96)04276-0.View ArticlePubMedGoogle Scholar
Wong LJ, Lueth M, Li XN, Lau CC, Vogel H: Detection of mitochondrial DNA mutations in the tumor and cerebrospinal fluid of medulloblastoma patients. Cancer Res. 2003, 63: 3866-3871.PubMedGoogle Scholar
Akimoto M, Niikura M, Ichikawa M, Yonekawa H, Nakada K, Honma Y, Hayashi J: Nuclear DNA but not mtDNA controls tumor phenotypes in mouse cells. Biochem Biophys Res Commun. 2005, 327: 1028-1035. 10.1016/j.bbrc.2004.12.105.View ArticlePubMedGoogle Scholar
Battino M, Gorini A, Villa RF, Genova ML, Bovina C, Sassi S, Littarru GP, Lenaz G: Coenzyme Q content in synaptic and non-synaptic mitochondria from different brain regions in the ageing rat. Mech Ageing Dev. 1995, 78: 173-187. 10.1016/0047-6374(94)01535-T.View ArticlePubMedGoogle Scholar
Genova ML, Bovina C, Marchetti M, Pallotti F, Tietz C, Biagini G, Pugnaloni A, Viticchi C, Gorini A, Villa RF, Lenaz G: Decrease of rotenone inhibition is a sensitive parameter of complex I damage in brain non-synaptic mitochondria of aged rats. FEBS Lett. 1997, 410: 467-469. 10.1016/S0014-5793(97)00638-8.View ArticlePubMedGoogle Scholar
Lai JC: Oxidative metabolism in neuronal and non-neuronal mitochondria. Can J Physiol Pharmacol. 1992, 70 Suppl: S130-7.View ArticlePubMedGoogle Scholar
Trounce I, Schmiedel J, Yen HC, Hosseini S, Brown MD, Olson JJ, Wallace DC: Cloning of neuronal mtDNA variants in cultured cells by synaptosome fusion with mtDNA-less cells. Nucleic Acids Res. 2000, 28: 2164-2170. 10.1093/nar/28.10.2164.View ArticlePubMedPubMed CentralGoogle Scholar
Ranes MK, El-Abbadi M, Manfredi MG, Mukherjee P, Platt FM, Seyfried TN: N -butyldeoxynojirimycin reduces growth and ganglioside content of experimental mouse brain tumours. Br J Cancer. 2001, 84: 1107-1114. 10.1054/bjoc.2000.1713.View ArticlePubMedPubMed CentralGoogle Scholar
Seyfried TN, el-Abbadi M, Roy ML: Ganglioside distribution in murine neural tumors. Mol Chem Neuropathol. 1992, 17: 147-167.View ArticlePubMedGoogle Scholar
Zimmerman HM, Arnould H: Experimental brain tumors: I. Tumors produced with methylcholanthrene. Cancer Res. 1941, 1: 919-938.Google Scholar
Rubin R, Sutton C: The ultrastructure of the mouse ependymoblastoma and its contained virus-like particles. J Neuropathol Exp Neurol. 1968, 27: 136-View ArticlePubMedGoogle Scholar
Mukherjee P, El-Abbadi MM, Kasperzyk JL, Ranes MK, Seyfried TN: Dietary restriction reduces angiogenesis and growth in an orthotopic mouse brain tumour model. Br J Cancer. 2002, 86: 1615-1621. 10.1038/sj.bjc.6600298.View ArticlePubMedPubMed CentralGoogle Scholar
Mukherjee P, Abate LE, Seyfried TN: Antiangiogenic and proapoptotic effects of dietary restriction on experimental mouse and human brain tumors. Clin Cancer Res. 2004, 10: 5622-5629.View ArticlePubMedGoogle Scholar
Manfredi MG, Lim S, Claffey KP, Seyfried TN: Gangliosides influence angiogenesis in an experimental mouse brain tumor. Cancer Res. 1999, 59: 5392-5397.PubMedGoogle Scholar
Seyfried TN, Yu RK, Saito M, Albert M: Ganglioside composition of an experimental mouse brain tumor. Cancer Res. 1987, 47: 3538-3542.PubMedGoogle Scholar
Cotterchio M, Seyfried TN: The influence of ImuVert, a biological response modifier, on the growth and ganglioside composition of murine neural tumors. Mol Chem Neuropathol. 1993, 20: 163-172.View ArticlePubMedGoogle Scholar
Fraser H: Brain tumours in mice, with particular reference to astrocytoma. Food Chem Toxicol. 1986, 24: 105-111. 10.1016/0278-6915(86)90344-3.View ArticlePubMedGoogle Scholar
El-Abbadi M, Seyfried TN, Yates AJ, Orosz C, Lee MC: Ganglioside composition and histology of a spontaneous metastatic brain tumour in the VM mouse. Br J Cancer. 2001, 85: 285-292. 10.1054/bjoc.2001.1909.View ArticlePubMedPubMed CentralGoogle Scholar
Bai H, Seyfried TN: Influence of ganglioside GM3 and high density lipoprotein on the cohesion of mouse brain tumor cells. J Lipid Res. 1997, 38: 160-172.PubMedGoogle Scholar
el-Abbadi M, Seyfried TN: Influence of growth environment on the ganglioside composition of an experimental mouse brain tumor. Mol Chem Neuropathol. 1994, 21: 273-285.View ArticlePubMedGoogle Scholar
Pon LA, Schon EA: Mitochondria. Methods in Cell Biology. Edited by: Wilson L and Matsudaira P. 2001, , Academic Press, 65: 20-23.Google Scholar
Yang J, Liu X, Bhalla K, Kim CN, Ibrado AM, Cai J, Peng TI, Jones DP, Wang X: Prevention of apoptosis by Bcl-2: release of cytochrome c from mitochondria blocked. Science. 1997, 275: 1129-1132. 10.1126/science.275.5303.1129.View ArticlePubMedGoogle Scholar
Bibb MJ, Van Etten RA, Wright CT, Walberg MW, Clayton DA: Sequence and gene organization of mouse mitochondrial DNA. Cell. 1981, 26: 167-180. 10.1016/0092-8674(81)90300-7.View ArticlePubMedGoogle Scholar
Heerdt BG, Chen J, Stewart LR, Augenlicht LH: Polymorphisms, but lack of mutations or instability, in the promotor region of the mitochondrial genome in human colonic tumors. Cancer Res. 1994, 54: 3912-3915.PubMedGoogle Scholar
Parfait B, Rustin P, Munnich A, Rotig A: Co-amplification of nuclear pseudogenes and assessment of heteroplasmy of mitochondrial DNA mutations. Biochem Biophys Res Commun. 1998, 247: 57-59. 10.1006/bbrc.1998.8666.View ArticlePubMedGoogle Scholar
Pedersen PL: Tumor mitochondria and the bioenergetics of cancer cells. Prog Exp Tumor Res. 1978, 22: 190-274.View ArticlePubMedGoogle Scholar
Cuezva JM, Chen G, Alonso AM, Isidoro A, Misek DE, Hanash SM, Beer DG: The bioenergetic signature of lung adenocarcinomas is a molecular marker of cancer diagnosis and prognosis. Carcinogenesis. 2004, 25: 1157-1163. 10.1093/carcin/bgh113.View ArticlePubMedGoogle Scholar
Floridi A, Paggi MG, Fanciulli M: Modulation of glycolysis in neuroepithelial tumors. J Neurosurg Sci. 1989, 33: 55-64.PubMedGoogle Scholar
Mangiardi JR, Yodice P: Metabolism of the malignant astrocytoma. Neurosurgery. 1990, 26: 1-19. 10.1097/00006123-199001000-00001.View ArticlePubMedGoogle Scholar
Ikezaki K, Black KL, Conklin SG, Becker DP: Histochemical evaluation of energy metabolism in rat glioma. Neurol Res. 1992, 14: 289-293.PubMedGoogle Scholar
Aisenberg AC: The Glycolysis and Respiration of Tumors. 1961, New York, Academic Press, 224-Google Scholar
Jazin EE, Cavelier L, Eriksson I, Oreland L, Gyllensten U: Human brain contains high levels of heteroplasmy in the noncoding regions of mitochondrial DNA. Proc Natl Acad Sci U S A. 1996, 93: 12382-12387. 10.1073/pnas.93.22.12382.View ArticlePubMedPubMed CentralGoogle Scholar
Taylor RW, Taylor GA, Durham SE, Turnbull DM: The determination of complete human mitochondrial DNA sequences in single cells: implications for the study of somatic mitochondrial DNA point mutations. Nucleic Acids Res. 2001, 29: E74-4. 10.1093/nar/29.15.e74.View ArticlePubMedPubMed CentralGoogle Scholar
This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
