Skip to main content

Table 1 Primers used for amplification of Mus Musculus mitochondrial genome

From: Absence of pathogenic mitochondrial DNA mutations in mouse brain tumors

Primer pair mtDNA bp Forward primer Reverse primer
1 15309-00040 GGTCTTGTAAACCTGAAATGAAG GCATTTTCAGTGCTTTGCTTTG
2 16173-01436 CTGATCAATTCTAGTAGTTCC CAAGCTCGTTAGGCTTTTCAC
3 01314–02880 GAATTACAGCTAGAAACCCCG CGTATGGACCAACAATGTTAGG
4 02673–03873 GTTATTAGGGTGGCAGAGCCAG GCCCGATAGCTTAATTAGCTGAC
5 03731–05324 CTTTGATAGAGTAAATTATAGAGG TAAAATGGCTGAGTAAGCATTAG
6 05194–06593 GTCTTAGTAGAGATTTCTCTACAC GTTTACTCCTACGAATATGATGG
7 06477–07996 GGAGCAGTGTTTGCTATCATAGC TGATGGCTACAACGATTGGGAATC
8 07847–09438 GTCTCATCACAAACATTCCCAC CAGAATCTACTAATTGGAAGTCAG
9 09307–10806 GATTTGAAGCCGCAGCATGATAC GTCATAGGTGAACTCCATATAATGG
10 10647–12399 GCCCTCATCTTAATCCAAAACC CTGTAGCTGCGATTAATAGGC
11 12247–13788 CAATCCTCTATAACCGCATCG GTATTGGGGGTGATTATAGAG
12 13670–15498 CCAACATCATCAACCTCATAC GTACTAGCTTATATGCTTGGG
  1. The nucleotide positions were based on Mus Musculus sequence from Bibb et al. 1981 [GenBank: V00711]