- Research
- Open access
- Published:
Sequential gene expression analysis of myelodysplastic syndrome transformation identifies HOXB3 and HOXB7 as the novel targets for mesenchymal cells in disease
BMC Cancer volume 24, Article number: 111 (2024)
Abstract
Background
Myelodysplastic syndrome (MDS) is known to arise through the pathogenic bone marrow mesenchymal stem cells (MSC) by interacting with hematopoietic stem cells (HSC). However, due to the strong heterogeneity of MDS patients, it is difficult to find common targets in studies with limited sample sizes. This study aimed to describe sequential molecular changes and identify biomarkers in MSC of MDS transformation.
Methods
Multidimensional data from three publicly available microarray and TCGA datasets were analyzed. MDS-MSC was further isolated and cultured in vitro to determine the potential diagnostic and prognostic value of the identified biomarkers.
Results
We demonstrated that normal MSCs presented greater molecular homogeneity than MDS-MSC. Biological process (embryonic skeletal system morphogenesis and angiogenesis) and pathways (p53 and MAPK) were enriched according to the differential gene expression. Furthermore, we identified HOXB3 and HOXB7 as potential causative genes gradually upregulated during the normal-MDS-AML transition. Blocking the HOXB3 and HOXB7 in MSCs could enhance the cell proliferation and differentiation, inhibit cell apoptosis and restore the function that supports hematopoietic differentiation in HSCs.
Conclusion
Our comprehensive study of gene expression profiling has identified dysregulated genes and biological processes in MSCs during MDS. HOXB3 and HOXB7 are proposed as novel surrogate targets for therapeutic and diagnostic applications in MDS.
Introduction
MDS is a group of clonal disorders characterized by morphologic dysplasia, ineffective hematopoiesis, and peripheral cytopenia [1], with a high risk of developing acute myeloid leukemia (AML) [2, 3]. The incidence rate of MDS in the general population is 4.5 per 100,000 people per year, but it is higher in males than females (6.2 vs. 3.3 per 100,000 people per year) and substantially increases with age. In addition to gender and age, other risk factors such as chemotherapy drugs, radiation therapy, long-term workplace exposure to benzene, or familial forms can also induce MDS to different degrees [4]. In clinical practice, epigenetic therapy is the main drug that can reverse the repressive state of DNA hypermethylation to relieve symptom, including azacitidine, decitabine, and lenalidomide [5], but sometimes it is still impossible to achieve a proper response to the therapy. Allogeneic HSC transplantation remains the only potentially curative option, but it is so strict that many people cannot be effectively cured through this approach [6]. Some studies indicate that the limited success of HSC transplantation was attributed to the altered BM microenvironment in MDS patients [7].
As one of the main cellular components of the BM microenvironment, MSCs that characterized by the expression of CD73 and CD90 are a group of stem cells that can repair themselves and have the ability to form bone, adipose and nerve cells [8,9,10]. Functionally, these cells can contribute to reprograming the BM microenvironment by dysregulating the proinflammatory cytokines and inducing the hypoxia, leading to abnormalities in supportive hematopoietic niches [11]. Although some reports suggest that there are no differences in phenotype and growth characteristics of MSC between MDS patients and healthy donors (HD) [12, 13], others believe that even though in the same phenotype MSC can also induce MDS appearing as different characteristics in diverse incubation circumstance [14, 15]. The controversy indicated that there must be some differences in the secreted molecules or cellular effects of MSC which are closely related to the gene expression profile of the MDS, playing an important role in the progression of MDS. However, the mechanism of MSC promoting the progression of MDS needs to be further explored.
Recently, gene chip technology has developed rapidly and been widely used in gene detection. Through it, we have learned that the pathogenesis and progression of heterogeneity in MDS are closely related to the MSC genetic landscape. For instance, Kim Me et al. have reported that MSC could regulate MDS pathogenesis through inflammation and immune dysregulation responses that involve the interferon signaling pathway [16], inducing an immune-suppressive microenvironment in MDS by an indirect mechanism involving monocytes or abnormal transforming growth factor β1, a relevant trigger causing MDS to progress to AML [17]. All of these have shown the feasibility and reliability of exploring MDS-MSC from the perspective of bioinformation. Therefore, a better understanding of the gene expression, developing a comprehensive list, or more consistent testing may help us acquire more useful information to improve the management of patients with MDS.
Driven by the need for effective biomarkers to improve the diagnosis and treatment of MDS, we specifically focused on screening persistently altered genes involved in MDS-MSC. We discovered the novel function of HOXB3 and HOXB7 where gene overexpression is closely associated with MDS progression. Simultaneously, blocking these genes can repair cell proliferation, differentiation, apoptosis and the ability of cells to promote HSC hematopoietic differentiation. Our work identifies HOXB3 and HOXB7 as potential targets for future interventions in MDS.
Materials and methods
Study population
Seventeen MDS patients and two healthy controls (They were diagnosed with nonhematologic diseases) were enrolled in this study. Experiments were approved by the ethics committee of the Second Hospital of Dalian Medical University. All study subjects signed a written informed consent before participating in the study.
RNA information acquisition
The gene expression data of MSC was obtained from the GEO database (GSE140101, GSE107490 and GSE61853) (http://www.ncbi.nlm.nih.gov/geo/). All the datasets included healthy donors as control and patients diagnosed with MDS. However, we didn’t analyze the differences in gene expression profiles of BM MSC between MDS subtypes. Total RNA was isolated from BM MSC for gene expression analysis comparing MDS vs. control. Databases were drawn through their portal for analysis [15,16,17]. The data sets which include the HD and MDS groups were screened and severally analyzed based on GPL10558 (Illumina HumanHT-12 V4.0 expression beadchip), GPL11154 (Illumina HiSeq 2000) and GPL16791 (Illumina HiSeq 2500). Meanwhile, the two samples with missing results in GSE61853 HD group were removed.
Data processing
The raw data downloaded from GEO were used for further analysis. Data processing mainly utilized a set of different R packages (R version 4.1.0 (2021-05-18)) in Rstudio. We downloaded Gene expression file GSE107490_all_count.txt.gz, GSE140101_ FPKM_GEO.txt.gz, GSE61853_non-normalized.txt.gz and their corresponding annotation platforms from the GEO database. The quality control of each data set was performed to minimize false detection rate (FDR) in original studies by using fastqcr package. Next, the expression matrix was normalized using the normalize Between Arrays function under limma package (version: 3.48.0). Gibberish was then removed. PCA under FactoMineR package was used to verify difference between samples and Reliability of data processing. The normalized data were further processed using the limma package to obtain differentially expressed genes (DEGs) between HD and MDS in these three gene sets. In our study, genes with a p-value less than 0.05 and fold-change greater than 2 were considered as DEGs. Each GSE has been analyzed statistically. Venn diagram tool (http://bioinformatics.psb.ugent.be/webtools/Venn/) was used to help us find overlapped genes.
GO enrichment and KEGG pathway analysis
To identify the overall overlapped genes enrichment differences between the patients and the controls, we used the Database for Annotation, Visualization and Integrated Discovery (https://david.ncifcrf.gov/, DAVID, version: 6.8) for the further functional enrichment analysis. This website can perform GO and KEGG analyses. The predicted BP (biological process), CC (cell composition), MF (molecular function) of the DEGs were analyzed. Furthermore, the pathways in which the DEGs participated were predicted and mapped using the KEGG database with DAVID. Visualization of the enriched GO terms and KEGG terms were conducted using the GO plot package (version: 1.0.2) in R studio. Terms with p values greater than 0.05 were considered statistically enriched.
PPI network establishment and further module analysis
To investigate protein-protein interaction function, the Search Tool for the Retrieval of Interacting Genes (http://string-db.org/, STRING) online database was used to identify interactions between known genes and predicted genes at the protein level. Briefly, we input the overlapped genes in the website using the default condition and downloaded the file about these proteins’ interaction to input into Cytoscape software (3.8.2) to obtain gene clusters. The plugins CytoHubba and MCODE in Cytoscape were applied to identify the significant modules in the PPI networks and calculate the degree exhibited by every protein node. Additionally, we extracted PPI pairs based on the combined score over 0.4. The degree cutoff was set to 2, node score cutoff to 0.2, k-score to 2 and Max depth to100 in MCODE.
Hub genes selection and correlation analysis
The screening of hub genes was mainly conducted through the MCODE plugin of Cytoscape. To perform the correlation analysis between the Hub genes and those genes that had been shown to influence the process of MDS, correlation analysis was carried out using the “tidyr”, “dplyr”, “ggstatsplot”, package (3.14.3) in R. Briefly, selected genes’ expression matrix was imported. The Cor.test function was then executed with the default parameters (type="spearman”) setting. Gene sets with a p-value less than 0.05 were considered to have significantly correlated relations.
Real-time quantitative polymerase chain reaction
For quantification of gene expression, RNA was isolated from Ctrl (They were diagnosed with nonhematologic diseases) or patients with MDS using a RNeasy Micro Kit or Rneasy Mini Kit (Qiagen). cDNA was synthesized from 1 µg RNA using Superscript IV Reverse transcription (Thermo Fisher) (37 °C for 15 min, 65 °C for 10 min). Real-time PCR analysis was set up with the SYBR Green qPCR Supermix kit (Invitrogen, Carlsbad, CA) and carried out in the iCycler thermal cycler. β-actin was used for normalization. Data were analyzed by the 2−ΔΔCT method [18]. Each sample was analyzed in triplicate, and the analysis was repeated three times. The primers for target genes were as follows.
Primers for HOXB3: forward-5′TGCTGCTGGGAGACTCGTAA 3′.
reverse-5′GCATCCCCTTGCAGCTAAAC 3′,
HOXB5 forward-5′AACTCTCCCCTCCCC ATC 3′.
reverse-5′GGCACTACCCCACCTCAA 3′,
HOXB6 forward-5′TCC CCTCCCAATGAGTTC 3′.
reverse-5 GCATAGCCCGA CGAATAGA 3′,
HOXB7 forward-5′CGTCCCTGCCTACAAATC 3′.
reverse-5′GAAGCAAA CGCACAAGAAG 3′,
SCF forward-5′ACCCAATGCGTGGACTATCTG 3′.
reverse-5′GGCGACTCCGTTTAGCTGTT 3′,
TPO forward-5′CTTCACTGCCTCAGCCAGAAC 3′.
reverse-5′GAATCCCTGCTGCCACTTCA 3′,
IGF1 forward-5′CCTCTCAAGAGCCACAAATGC 3′.
reverse-5′TCCAGCAGCCAAGATTCAGA 3′,
IGFBP2 forward-5′TGACAAGCATGGCCTGTACAA 3′.
reverse-5′CACGCTGCCCGTTCAGA 3′,
CXCL12 forward-5′ATGTCGAAGCCCCATAGTGAA 3′.
reverse-5′TGGGTGGTGAATCAATGTCCA 3′,
β-ACTIN forward-5′CATGTACGTTGCTATCCAGGC 3′.
reverse-5′CTCCTTAATGTCACGCACGAT 3′.
Cell transfection
MSC cells were seeded 2 × 105 cells per well in 6-well culture plates with DMEM/F-12 medium containing 10% FBS for one day. When cells were grown to a concentration of 70%, transient transfection was performed using the transfection reagent GP-transfectMate (GenePharma, China) according to the manufacturer’s protocol. The MSC were then transfected with HOXB3 or HOXB7 small interfering RNA (siRNA) (GenePharma, China) and a non-speciffc control siRNA (NCsiRNA). SiRNA was mixed with GP-transfect-Mate transfection reagent in serum-free medium according to the manufacturer’s instructions incubated for 6 h, then the cells were incubated in a Growth Medium for following analysis. The siRNA sequences are as follow:
siRNA HOXB3: sense-5′GAUGAAAG AGUCGAGGCAATT 3′
antisense-5′UUGCCUCGACUCUUUC AUCTT 3′,
siRNA HOXB7: sense-5′GCUAUUGUAAGGUCUUUGUTT 3′
antisense-5′ACAAAGACCUUACAAUAGCTT 3′
CCK-8 assay
MSCs were seeded in 96-well cell culture plates. Cells were transfected when they reached a density of 40–60%. Cell proliferation was assessed every 24 h after transfection by measuring absorbance at 450 nm with a multiskan-FC (Thermo Fisher) according to the instructions of the CCK-8 kit (Vazyme).
apoptosis assay
After 24 h of transfection, the cells were treated according to the instructions of the eBioscience Annexin V-FITC Apop Kit (Thermo Fisher) and detected by flow cytometry. Finally, the data were statistically analyzed using Graphpad Prism software to plot the cell distribution. Three replicates were set for each group.
Assay of adipogenic differentiation and osteogenic differentiation
After transfecting with HOXB3 or HOXB7, MSC were collected and cultured with adipogenesis induction medium (α-MEM containing 10% FBS, 5 µg/mL insulin, 0.5 mmol/L 3-isobutyl-1-methylxanthine, and 1 µmol/L dexamethasone) in 6-well plates with 1 × 105 cells per well for 14 days. Every three days, we changed culture medium. We used Oil Red O staining to distinguish mature adipocytes from preadipocyte during the process of culture. For osteogenic differentiation, MSC were inoculated in 6-well plates with 1 × 105 cells per well and cultured in freshly formed osteogenic medium (OM) for 21 days. Alizarin Red staining was used to detect bone mineralization.
Colony forming unit (CFU) assay
MDS-MSC (with or without HOXB3/7 treatment) were plated at a near confluent density of 1.0 × 104 cells per well in 48-well plates. 24 h later, healthy CD34 + HSC were seeded in contact with the MSC feeder layer at a density of 5.0 × 105 cells per well in hematopoietic media and cultured for up to 5 days. Then, HSC were cultured in methylcellulose media (MethoCult™ H4434, STEMCELL) for 14 days and colonies were counted using an inverted microscope.
Survival analysis
The overall survival (OS) analysis of hub genes was conducted using the Kaplan-Meier curve in cBioPortal. cBioPortal (http://www.cbioportal.org) is an online analysis platform for multidimensional cancer genomic data that visualizes genes, samples and data types. Survival analysis was performed by alternating the Hub genes on line. And P-value less than 0.05 was considered statistically significant.
Statistical analysis
The data are displayed as histograms and line charts. The parameters were compared using one- or two- way analysis of variance. Data are representative of at least three independent experiments. Statistical analysis was performed using Prism 8.4.3 (GraphPad Software, La Jolla, California). A p-value lower than 0.05 was considered statistically significant.
Results
Data series and DEGs identification
We obtained the gene expression profiles from three data series (GSE61853, GSE140101, and GSE107490) of MSC samples in BM from MDS patients and HD in the GEO database. We picked and analyzed the corresponding samples in series matrix by Rstudio (the details were shown in the Data Sheet). As shown in Fig. 1, we screened 330, 660 and 477 differentially expressed genes from GSE61853, GSE140101 and GSE107490, respectively, based on the criteria of P values less than 0.01 and| log2FC| over 1.0, and we displayed the top 13% of total DEGs (Fig. 1A). In addition, we created volcano plots for the three data series to present the top 10 up-regulated and down-regulated genes from different data series (Fig. 1B). PCA demonstrated reliability of data processing of these three-date series is credible (Fig. 1C). Next, we obtained the overlap among each two DEG profiles via Venn analysis. The results showed that 62 DGEs were captured totally by intersections (Fig. 1D). Notably, two DEGs showed obvious differential expression in all these groups, including PSG5 (the human pregnancy-specific glycoproteins) and SLC5A3 (solute carrier family 5 - inositol transporters member 3) (Fig. 1D). Furthermore, all of 54 of 62 shared genes exhibited the same tendency, and the hub genes were presented in Table 1.
The key pathways and PPI network analyses of DEGs
To gain further insight into the function of the 62 shared DEGs, we performed functional and pathway enrichment analyses using DAVID. The top 12 results were showed in Table 2. The functions were categorized into 4 groups: BP, CC, MF and KEGG pathway. GO analysis revealed that the function of DEGs mainly enriched in following term, embryonic skeletal system morphogenesis, angiogenesis, anterior/posterior pattern specification, sequence-specific DNA binding, platelet degranulation, growth factor activity, presynaptic membrane, negative regulation of transcription from RNA polymerase II promoter, positive regulation of epidermal growth factor-activated receptor activity, regulation of protein localization to cell surface, anatomical structure morphogenesis. KEGG pathway mainly showed enrichment in p53 signaling pathway and MAPK signaling pathway (Fig. 2A).
To analyze the interaction among the DEGs, we used STRING to assist in determining the PPI network. The results showed that the PPI network involved 62 nodes together with 132 edges (Fig. 2B). Furthermore, we obtained three significant modules based on the degree of importance by utilizing cluster analysis of the PPI network in Cytoscape MCODE. Module 1 contained 9 nodes and 81 edges; Module 2 contained 5 nodes and 23 edges; Module 3 contained 4 nodes and 16 edges (Fig. 2C). The top cluster included KRTI8, TFAP2A, PITX2, HOXB5, SHOX2, TBX15, HOXB3, HOXB6, and HOXB7. Then, we identified the top ten genes under the evaluation of the degree of connectivity in PPI network. These results indicated that PITX2 (score = 1542) exhibited the largest score of connectivity, followed by TFAP2A (score = 1515), HOXB7 (score = 1476), SHOX2 (score = 1466), HOXB6 (score = 1441), HOXB5 (score = 1440), TBX15 (score = 724), HOXB3 (score = 720), EGF (score = 380), SERPINE1 (score = 324) (Fig. 2D). Based on the results of DAVID clustering and degree score, we focused on possible potential core genes HOX (homeotic genes) and its four subtypes: HOXB3, HOXB5, HOXB6, HOXB7.
Blocking HOXB3 or HOXB7 could repair the function of MSC
Over all, we found that the expression of HOXB3, HOXB5, HOXB6, HOXB in MDS-MSC was significantly upregulated. To confirm the expression changes founded in the whole genome sequencing, we performed qRT-PCR to verify results of HOXB3, HOXB5, HOXB6 and HOXB7 DGE in MDS-MSCversus HD-MSCs. As expected, HOXB3 and HOXB7 were highly expressed in MDS-MSC compared with Ctrl-MSCs. But we didn’t obtain the difference of HOXB5 and HOXB6 at the transcript level because of the limited sample size (Fig. 3A). Subsequently, we performed correlation analysis between HOXB3, HOXB5, HOXB6 and HOXB7 in sample data and found that the expression of hub genes was correlated with each other (Fig. 3B). Based on the bioinformatics results, we selected HOXB3 and HOXB7 as the next key research objects.
To analyze the effect of HOXB3 and HOXB7 on MSCs’ function, cells were transfected with siRNA separately to block the expression of HOXB3 and HOXB7. Subsequently, RT-qPCR was performed to verify the effectiveness of siRNA. The mRNA level of HOXB3 and HOXB7 was significantly reduced upon transfecting (Fig. 4A). Cell number is closely related to cell function. First, we performed the CCK-8 assay to analyze cell proliferation. The results showed that HOXB3, but not HOXB7, was effective in promoting the proliferation of MSC, as indicated by the statistically significant difference between the siRNA HOXB3 group and the control group (P < 0.05) (Fig. 4B). Then, cell apoptosis was analyzed through flow cytometry. We found that blocking HOXB3 or HOXB7 could reduce MSCs apoptosis (Fig. 4C). As we all know, MSCs can differentiate into different cells to support bone marrow function. The differentiation ability of MSCs was analyzed after blocking HOXB3 or HOXB7. The results showed that blocking HOXB3 or HOXB7 could strengthen the formation of lipid droplets (Fig. 4D), and significantly enhanced mineral deposition compared to the control (Fig. 4E). All these results revealed that HOXB3 and HOXB7, which were overexpressed in MDS-MSC, inhibited cell proliferation, adipogenic differentiation, osteogenic differentiation and promoting cell apoptosis.
It has been reported that MSC secrete some hematopoietic cytokines, which play a role in hematopoietic support functions of MSC [19,20,21]. In addition to the effects on MSC cells themselves, we also examined the function that supporting hematopoiesis differentiation of HSCs. RT-qPCR assay showed that mRNA expression of SCF, TPO, IGF1, IGFBP2 and CXCL12, which could support HSC function, was increased after blocking HOXB3 or HOXB7 in MSCs. There was a statistically significant difference in expression of SCF between the siRNA HOXB3 group and the control (P < 0.05) (Fig. 4F). In addition, HSC had high CFU-colony forming efficiency after co-incubation with MSC that downregulated the expression of HOXB3 or HOXB7 (Fig. 4G). All these results revealed that blocking HOXB3 or HOXB7 in MSCs could repair the function that supporting hematopoiesis differentiation of HSCs.
The identification of hub genes in MDS progression
To predict the role of hub genes, we screened a series of genes that have been shown to influence the process of MDS, such as TET2, DNMT3A, ASXL1, EZH2, SF3B1, SRSF2, U2AF1, ZRSR2, RUNX1, TP53, STAG2, NRAS, CBL, NF1, for correlation analysis. The results showed that the hub genes were significantly correlated with disease genes in GSE140101 and GSE107490, respectively (Fig. 5A).
As we all know, MDS high-risk patients have an increased propensity to evolve to AML. Therefore, we first selected the expression matrix of Hub genes in HD, MDS and AML to plot a heatmap (Fig. 5B). The Kaplan-Meier curve was employed to predict the prognosis of the 4 identified Hub genes. Among the genes examined, MDS patients having HOXB3, HOXB5, HOXB6, HOXB7 alterations showed worse Overall Survival (OS) (Fig. 5C). Although the difference of HOXB3 was not statistically significant, the OS of patients having HOXB3 alteration showed an obvious decline tendency (Fig. 5D). Survival analysis showed that HOXB5, HOXB6, HOXB7 alterations significantly shortened survival (Fig. 5E, F and G).
Discussion
MDS is a clonal hematopoietic system disease that is difficult to diagnose, characterized by reduced hematopoietic function, peripheral blood cytopenia and morphogenesis [22]. According to the revised version of the International Prognostic Scoring System (IPSS-R), MDS can be divided into different subtypes. The treatment for MDS in the risk group included component blood infusion, hematopoietic factor therapy, immunomodulator and epigenetic drug therapy. But only a few drugs are currently available for treatment, more drugs are now under clinical investigation [23], and overcoming MDS remains a challenge for us.
In recent years, targeted therapies are emerging for small subsets of MDS patients with specific somatic mutations (such as TP53, IDH1/2, FLT3). But currently, they have not been approved widely for use as mutation-directed medications of treating MDS [23]. At the same time, accumulated data indicate that MSC in MDS model display aberrant characteristics contributing to disease initiation and transformation into AML [24]. Hence, it is very urgent to identify potential markers, especially in MSC, to promote the diagnosis and prognosis of MDS. Therefore, in the research we analyzed the potential therapeutic targets of MSC in MDS patients based on bioinformatics, to find potential therapeutic targets of MDS.
Due to the strong heterogeneity of MDS patients and significant changes in the course of the disease, it is difficult to find common targets in limited sample size studies. Here, we used three databases containing MDS and HD samples, including GSE140101, GSE107490, and GSE61853 from GEO. Significantly, differences of PSG5 (a putative AF (Amniotic fluid)-MSC markers [25]) and SLC5A3 (essential to support a myo-inositol auxotrophy in AML [26]) were expressed in various stages of MDS in these data. In order to find more potential targets on MDS-MSC, we integrated the differential genes in three databases to obtain 62 differential genes, all of them appear more than twice in three Dataset. Furthermore, GO enrichment analysis indicated that the identified DEGs were mainly enriched in embryonic skeletal system morphogenesis, angiogenesis, anterior/posterior pattern specification, sequence-specific DNA binding and platelet degranulation. They were all related to growth and development, which showed abnormal biological processes associated with cellular phenotypes and transcriptional regulation in MSC. Actually, they had been taken as the more important cause of MDS, similar to the study in 2013 conducted by Geyh S et al., in which they reported that MSC are structurally, epigenetically and functionally altered, which leads to impaired stromal support and seems to contribute to deficient hematopoiesis in MDS [27]. Then KEGG enrichment analysis shown the difference were enriched in P53 signaling pathway representing the tumor suppression and MAPK signaling pathway, playing a key role in the differentiation, proliferation and apoptosis of cells [28, 29]. This clearly proved that inhibition of MSC played important roles in the transformation from MDS to AML, although some research had shown that there were no differences observed with respect to phenotype, differentiation capacity, immunomodulatory capacity or hematopoietic support in MSC between MDS and HD [30].
By establishing the PPI network of DEGs, we picked out HOXB3, HOXB5, HOXB6, and HOXB7 as hub genes with the highest degrees. And, our experiment results manifest that HOXB3 and HOXB7 significantly regulates hematopoiesis capacity in MSC at the process of MDS and plays a key role. Homeotic (HOX) genes, a group of genes regulating the body shape, are developed in regulatory system and transcription factor that causes cell differentiation blocking and malignant self-renewal [31, 32]. The role of the HOXB3 varies in different tumors. Some studies suggested that loss of HOXB3 correlates with the development of hormone receptor negative breast cancer [31], or act as tumor suppressors through FLT3-ITD driver in AML [33]. But some scholars believe that HOXB3 promotes prostate cancer cell progression by transactivating CDCA3 [34]. We found that the gene expression of HOXB3 was increased significantly indicating that it may associate with malignant lesions of MDS. Different from HOXB3, HOXB5 was negatively correlated with myeloid cell differentiation signaling [35], but promoted tumor aggression and progression of various tumors including AML [36, 37]. According to our results, HOXB5 may promote the progression of MDS to AML. Abnormalities of the HOXB6 expression in granulopoiesis and monocytopoiesis may contribute to the development of the leukemic phenotype appearing as its overexpression in murine BM and generating a myelomonocytic precursor in vitro [38], and causes HSC expansion and AML in vivo [39]. As expected, HOXB6 increased significantly also in MDS-MSC in our results. HOXB7 that can induce activation of MAPK/ERK pathway which promotes tumor progression is also upregulated in MDS-MSC [40]. The results implied that the HOX family, especially the overexpression of HOXB3, HOXB5, HOXB6, HOXB7, played important roles in normal and malignant hematopoiesis in MSC of MDS. Furthermore, to demonstrate the importance of hub genes, we screened a series of genes, including TET2, DNMT3A, ASXL1, EZH2, SF3B1, SRSF2, U2AF1, ZRSR2, RUNX1, TP53, STAG2, NRAS, CBL, NF1, which had been shown to influence the procedure of MDS, for correlation analysis. As predicted, significant correlations indicated the important roles of hub genes. At the same time, survival analysis showed that MDS patients having HOXB3, HOXB5, HOXB6, HOXB7 alterations showed worse OS. Furthermore, we explored the function of hub genes in MDS-MSC that obtained through bioinformatics analysis in vitro. The results showed that compared with other genes, HOXB3 and HOXB7 could regulate the function of MSCs cells to a greater extent. But because of the size and source of sample, the results need to be more explored.
However, due to a shortfall of the underlying data acquisition technology, false positive results may occur, which is also the biggest flaw of this paper. In addition, recently, different views on the pathogenic role of MSC in MDS have been raised. The researchers believed that although MDS-MSC displayed higher mutational burdens compared to healthy MSCs, no evidence for acquired mutations as disease initiators for MDS was found [41]. Next, more samples of MDS patients will be collected to verify the conclusions through experiments.
In conclusion, our findings predicted that dysplasia of MDS-MSC is closely related to the pathogenesis of MDS through altered HOXB family, providing potential targets for therapeutic and diagnostic applications in MDS.
Data availability
The data that support the findings of this study are openly available in National Center for Biotechnology Information at https://www.ncbi.nlm.nih.gov/, with the reference number as GSE140101, GSE107490 and GSE61853. The OS analysis of hub genes was performed using the Kaplan-Meier curve in cBioPortal (http://www.cbioportal.org).
Abbreviations
- MDS:
-
Myelodysplastic syndrome
- BM:
-
Bone marrow
- MSC:
-
Mesenchymal stem cells
- HSC:
-
Hematopoietic stem cells
- HD:
-
Healthy donors
- AML:
-
Acute myeloid leukemia
- BP:
-
Biological process
- CC:
-
Cell composition
- MF:
-
Molecular function
- FDR:
-
False detection rate
- GO:
-
Gene Ontology
- KEGG:
-
Kyoto Encyclopedia of Genes and Genomes
- OS:
-
Overall Survival
References
Alvarez-Larran A, Lopez-Guerra M, Rozman M, Correa JG, Hernandez-Boluda JC, Tormo M, Martinez D, Martin I, Colomer D, Esteve J, et al. Genomic characterization in triple-negative primary myelofibrosis and other myeloid neoplasms with bone marrow fibrosis. Ann Hematol. 2019;98(10):2319–28.
Chang YH. Myelodysplastic syndromes and overlap syndromes. Blood Res. 2021;56(S1):51–S64.
Lindsley RC, Saber W, Mar BG, Redd R, Wang T, Haagenson MD, Grauman PV, Hu ZH, Spellman SR, Lee SJ, et al. Prognostic mutations in myelodysplastic syndrome after stem-cell transplantation. N Engl J Med. 2017;376(6):536–47.
Platzbecker U, Kubasch AS, Homer-Bouthiette C, Prebet T. Current challenges and unmet medical needs in myelodysplastic syndromes. Leukemia. 2021;35(8):2182–98.
Veryaskina YA, Titov SE, Kovynev IB, Fedorova SS, Pospelova TI, Zhimulev IF. MicroRNAs in the Myelodysplastic Syndrome. Acta Naturae. 2021;13(2):4–15.
Platzbecker U. Treatment of MDS. Blood. 2019;133(10):1096–107.
Gupta VA, Matulis SM, Conage-Pough JE, Nooka AK, Kaufman JL, Lonial S, Boise LH. Bone marrow microenvironment-derived signals induce Mcl-1 dependence in multiple myeloma. Blood. 2017;129(14):1969–79.
Uder C, Bruckner S, Winkler S, Tautenhahn HM, Christ B. Mammalian MSC from selected species: features and applications. Cytometry A. 2018;93(1):32–49.
Schroeder T, Geyh S, Germing U, Haas R. Mesenchymal stromal cells in myeloid malignancies. Blood Res. 2016;51(4):225–32.
Jiang B, Yao G, Tang X, Yang X, Feng X. MSCs relieve SLE by modulation of Th17 cells through MMPs–CCL2–CCR2–IL-17 pathway. 2021, 1(1):30–9.
Huang JC, Basu SK, Zhao X, Chien S, Fang M, Oehler VG, Appelbaum FR, Becker PS. Mesenchymal stromal cells derived from acute myeloid leukemia bone marrow exhibit aberrant cytogenetics and cytokine elaboration. Blood Cancer J. 2015;5:e302.
Rathnayake AJ, Goonasekera HW, Dissanayake VH. Phenotypic and Cytogenetic Characterization of Mesenchymal Stromal Cells in De Novo Myelodysplastic Syndromes. Anal Cell Pathol (Amst) 2016, 2016:8012716.
Abbas S, Kumar S, Srivastava VM, Therese MM, Nair SC, Abraham A, Mathews V, George B, Srivastava A. Heterogeneity of mesenchymal stromal cells in Myelodysplastic Syndrome-with Multilineage Dysplasia (MDS-MLD). Indian J Hematol Blood Transfus. 2019;35(2):223–32.
Corradi G, Baldazzi C, Ocadlikova D, Marconi G, Parisi S, Testoni N, Finelli C, Cavo M, Curti A, Ciciarello M. Mesenchymal stromal cells from myelodysplastic and acute myeloid leukemia patients display in vitro reduced proliferative potential and similar capacity to support leukemia cell survival. Stem Cell Res Ther. 2018;9(1):271.
Sarhan D, Wang J, Sunil Arvindam U, Hallstrom C, Verneris MR, Grzywacz B, Warlick E, Blazar BR, Miller JS. Mesenchymal stromal cells shape the MDS microenvironment by inducing suppressive monocytes that dampen NK cell function. JCI Insight 2020, 5(5).
Kim M, Hwang S, Park K, Kim SY, Lee YK, Lee DS. Increased expression of interferon signaling genes in the bone marrow microenvironment of myelodysplastic syndromes. PLoS ONE. 2015;10(3):e0120602.
Geyh S, Rodriguez-Paredes M, Jager P, Koch A, Bormann F, Gutekunst J, Zilkens C, Germing U, Kobbe G, Lyko F, et al. Transforming growth factor beta1-mediated functional inhibition of mesenchymal stromal cells in myelodysplastic syndromes and acute myeloid leukemia. Haematologica. 2018;103(9):1462–71.
Chen W, Yu Y, Zheng SG, Lin J. Human gingival tissue-derived mesenchymal stem cells inhibit proliferation and invasion of rheumatoid fibroblast-like synoviocytes via the CD39/CD73 signaling pathway. 2023, 3(2):90–9.
Zhao ZG, Xu W, Yu HP, Fang BL, Wu SH, Li F, Li WM, Li QB, Chen ZC, Zou P. Functional characteristics of mesenchymal stem cells derived from bone marrow of patients with myelodysplastic syndromes. Cancer Lett. 2012;317(2):136–43.
Miao R, Lim VY, Kothapalli N, Ma Y, Fossati J, Zehentmeier S, Sun R, Pereira JP. Hematopoietic stem cell niches and signals Controlling Immune Cell Development and maintenance of immunological memory. Front Immunol. 2020;11:600127.
Poon Z, Dighe N, Venkatesan SS, Cheung AMS, Fan X, Bari S, Hota M, Ghosh S, Hwang WYK. Bone marrow MSCs in MDS: contribution towards dysfunctional hematopoiesis and potential targets for disease response to hypomethylating therapy. Leukemia. 2019;33(6):1487–500.
Hosono N. Genetic abnormalities and pathophysiology of MDS. Int J Clin Oncol. 2019;24(8):885–92.
Scalzulli E, Pepe S, Colafigli G, Breccia M. Therapeutic strategies in low and high-risk MDS: what does the future have to offer? Blood Rev. 2021;45:100689.
Pang YB, Li WW, Luo JM, Ji J, Du X. [Senescent mesenchymal stem cells contribute to progression of myelodysplastic Syndromes-Review]. Zhongguo Shi Yan Xue Ye Xue Za Zhi. 2018;26(3):942–6.
Wei Y, Huang YH, Skopelitis DS, Iyer SV, Costa ASH, Yang Z, Kramer M, Adelman ER, Klingbeil O, Demerdash OE, et al. SLC5A3-Dependent Myo-Inositol Auxotrophy in Acute myeloid leukemia. Cancer Discov. 2022;12(2):450–67.
Tejeda-Mora H, Leon LG, Demmers J, Baan CC, Reinders MEJ, Bleck B, Lombardo E, Merino A, Hoogduijn MJ. Proteomic analysis of mesenchymal stromal cell-derived extracellular vesicles and reconstructed membrane particles. Int J Mol Sci 2021, 22(23).
Geyh S, Oz S, Cadeddu RP, Frobel J, Bruckner B, Kundgen A, Fenk R, Bruns I, Zilkens C, Hermsen D, et al. Insufficient stromal support in MDS results from molecular and functional deficits of mesenchymal stromal cells. Leukemia. 2013;27(9):1841–51.
Inamura N, Araki T, Enokido Y, Nishio C, Aizawa S, Hatanaka H. Role of p53 in DNA strand break-induced apoptosis in organotypic slice culture from the mouse cerebellum. J Neurosci Res. 2000;60(4):450–7.
Chen SX, Zhao F, Huang XJ. [MAPK signaling pathway and erectile dysfunction]. Zhonghua Nan Ke Xue. 2018;24(5):442–6.
Calkoen FG, Vervat C, van Pel M, de Haas V, Vijfhuizen LS, Eising E, Kroes WG, t Hoen PA, van den Heuvel-Eibrink MM, Egeler RM, et al. Despite differential gene expression profiles pediatric MDS derived mesenchymal stromal cells display functionality in vitro. Stem Cell Res. 2015;14(2):198–210.
Zhu L, Yu S, Jiang S, Ge G, Yan Y, Zhou Y, Niu L, He J, Ren Y, Wang B. Loss of HOXB3 correlates with the development of hormone receptor negative breast cancer. PeerJ. 2020;8:e10421.
Mallo M. Reassessing the role of hox genes during Vertebrate Development and Evolution. Trends Genet. 2018;34(3):209–17.
Lindblad O, Chougule RA, Moharram SA, Kabir NN, Sun J, Kazi JU, Ronnstrand L. The role of HOXB2 and HOXB3 in acute myeloid leukemia. Biochem Biophys Res Commun. 2015;467(4):742–7.
Bi L, Zhou B, Li H, He L, Wang C, Wang Z, Zhu L, Chen M, Gao S. A novel miR-375-HOXB3-CDCA3/DNMT3B regulatory circuitry contributes to leukemogenesis in acute myeloid leukemia. BMC Cancer. 2018;18(1):182.
Zhang J, Zhang S, Li X, Zhang F, Zhao L. HOXB5 promotes the progression of breast cancer through wnt/beta-catenin pathway. Pathol Res Pract. 2021;224:153117.
Sakamaki T, Kao KS, Nishi K, Chen JY, Sadaoka K, Fujii M, Takaori-Kondo A, Weissman IL, Miyanishi M. Hoxb5 defines the heterogeneity of self-renewal capacity in the hematopoietic stem cell compartment. Biochem Biophys Res Commun. 2021;539:34–41.
Chen M, Qu Y, Yue P, Yan X. The prognostic value and function of HOXB5 in Acute myeloid leukemia. Front Genet. 2021;12:678368.
Giampaolo A, Felli N, Diverio D, Morsilli O, Samoggia P, Breccia M, Lo Coco F, Peschle C, Testa U. Expression pattern of HOXB6 homeobox gene in myelomonocytic differentiation and acute myeloid leukemia. Leukemia. 2002;16(7):1293–301.
Fischbach NA, Rozenfeld S, Shen W, Fong S, Chrobak D, Ginzinger D, Kogan SC, Radhakrishnan A, Le Beau MM, Largman C, et al. HOXB6 overexpression in murine bone marrow immortalizes a myelomonocytic precursor in vitro and causes hematopoietic stem cell expansion and acute myeloid leukemia in vivo. Blood. 2005;105(4):1456–66.
Dai L, Hu W, Yang Z, Chen D, He B, Chen Y, Zhou L, Xie H, Wu J, Zheng S. Upregulated expression of HOXB7 in intrahepatic cholangiocarcinoma is associated with tumor cell metastasis and poor prognosis. Lab Invest. 2019;99(6):736–48.
Jann JC, Mossner M, Riabov V, Altrock E, Schmitt N, Flach J, Xu Q, Nowak V, Oblander J, Palme I, et al. Bone marrow derived stromal cells from myelodysplastic syndromes are altered but not clonally mutated in vivo. Nat Commun. 2021;12(1):6170.
Acknowledgements
We thank all the members in the Department of Immunology, Dalian Medical University for their input on these studies.
Funding
This work was supported by the Doctoral Start-up Foundation of Liaoning Province[2021-BS-205], Dalian Medical University Iterdisciplinary Research Cooperation Project Team Funding [JCHZ2023010], Basic Research Projects of Liaoning Provincial Department of Educationand Dalian Key Laboratory of Human Homeostasis Microbiology and Disease Immunology.
Author information
Authors and Affiliations
Contributions
Chunlai Yin, and Yanqi Li contributed equally to this work. Chunlai Yin designed the overall idea of this study, collated tables and figures, wrote the drafts of the paper and provided the fund. Yanqi Li performed bioinformatics analysis and the in vitro experiment, collated tables and figures, and wrote the drafts of the paper. Weiping Li re-diagnosed the samples recruited and scored the results. Cheng Zhang, Shizhu Zang, Zilong Wang and Xue Yan contributed to the data verification. Tonghui Ma supervised this study, Xia Li and Weiping Li supervised this study and revised the drafts of the paper. All authors read and approved the final manuscript.
Corresponding authors
Ethics declarations
Ethics approval and consent to participate
This study was conducted in accordance with the Declaration of Helsinki and approved by the Ethics Committee and Institutional Review Board of the Second Hospital of Dalian Medical University (2019 − 151), and all patients signed informed consent forms.
Consent for publication
Not applicable.
Competing interests
The authors declare no competing interests.
Additional information
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
About this article
Cite this article
Yin, C., Li, Y., Zhang, C. et al. Sequential gene expression analysis of myelodysplastic syndrome transformation identifies HOXB3 and HOXB7 as the novel targets for mesenchymal cells in disease. BMC Cancer 24, 111 (2024). https://doi.org/10.1186/s12885-024-11859-w
Received:
Accepted:
Published:
DOI: https://doi.org/10.1186/s12885-024-11859-w