Skip to main content

Evaluation of the expression levels of BRAFV600E mRNA in primary tumors of thyroid cancer using an ultrasensitive mutation assay

Abstract

Background

The BRAFV600E gene encodes for the mutant BRAFV600E protein, which triggers downstream oncogenic signaling in thyroid cancer. Since most currently available methods have focused on detecting BRAFV600E mutations in tumor DNA, there is limited information about the level of BRAFV600E mRNA in primary tumors of thyroid cancer, and the diagnostic relevance of these RNA mutations is not known.

Methods

Sixty-two patients with thyroid cancer and non-malignant thyroid disease were included in the study. Armed with an ultrasensitive technique for mRNA-based mutation analysis based on a two step RT-qPCR method, we analysed the expression levels of the mutated BRAFV600E mRNA in formalin-fixed paraffin-embedded samples of thyroid tissues. Sanger sequencing for detection of BRAFV600E DNA was performed in parallel for comparison and normalization of BRAFV600E mRNA expression levels.

Results

The mRNA-based mutation detection assay enables detection of the BRAFV600E mRNA transcripts in a 10,000-fold excess of wildtype BRAF counterparts. While BRAFV600E mutations could be detected by Sanger sequencing in 13 out of 32 malignant thyroid cancer FFPE tissue samples, the mRNA-based assay detected mutations in additionally 5 cases, improving the detection rate from 40.6 to 56.3%. Furthermore, we observed a surprisingly large, 3-log variability, in the expression level of the BRAFV600E mRNA in FFPE samples of thyroid cancer tissue.

Conclusions

The expression levels of BRAFV600E mRNA was characterized in the primary tumors of thyroid cancer using an ultrasensitive mRNA-based mutation assay. Our data inspires further studies on the prognostic and diagnostic relevance of the BRAFV600E mRNA levels as a molecular biomarker for the diagnosis and monitoring of various genetic and malignant diseases.

Peer Review reports

Background

Thyroid cancer is the most frequent endocrine cancer and the fourth most common cancer in women, with a worldwide annual incidence of 3.1% [1]. One of the most important events in the progression of thyroid cancer is the occurrence of the BRAFV600E mutation, which can be detected in 29–83% of cases [2]. This somatic missense mutation at the nucleotide position 1799 T > A results in substitution of glutamic acid (E) for valine (V) at codon 600 [3]. The constitutively active BRAFV600E protein transduces mitogenic signals from the cell membrane to the nucleus, thus leading the deregulation of cell proliferation and oncogenesis [4,5,6]. Detection of the BRAFV600E mutation in DNA has been consistently reported as a useful prognostic and diagnostic biomarker in thyroid cancer [7, 8].

Up to date, there are several methods for BRAFV600E DNA mutation testing, including Sanger sequencing [9], pyrosequencing [10], allele-specific PCR (AS-PCR) [11], high resolution melting (HRM) analysis [12], and COLD-PCR [13]. These methods vary in sensitivity, specificity, assay complexity and costs. Although Sanger sequencing exhibits highly reliable and specific outputs, it suffers from the risk of handling contamination, costly, time consuming, and a relatively low sensitivity, requiring a 7–20% mutant allele frequency for reliable detection [9]. In comparison, allele-specific PCR (AS-PCR), high resolution melting analysis, COLD-PCR have been reported to have an analytical sensitivity ranging from 0.1 to 2%, 1 and 3.1%, respectively [11,12,13].

As an alternative to DNA-based mutation assays, antibody-based test using the monoclonal antibody VE1 has recently been reported to specifically detect the presence of mutant BRAFV600E protein in tumor specimens [14]. This IHC detection enables visualization of the distribution of BRAFV600E mutant protein at a single-cell level with semiquantitative readout of protein abundance, thus improving sensitivity and specificity in comparison to DNA-based tests. High heterogeneity of BRAFV600E expression, causing false negatives, and restrictions for other BRAF variants are the main weaknesses of this method [15].

Despite various methods for BRAFV600E mutation analysis at both the DNA and protein levels, there is still limited information regarding the mRNA level of the mutated BRAFV600E allele in primary thyroid cancer tumors. The use of mRNA as a template allows for measuring mRNA levels of the mutated and wildtype genes, which, like protein-based testing, might reflect the functional consequences of the mutated genes in cell and tissue more accurately than assays based on detection of the mutation in DNA only. Furthermore, the number of mRNA molecules of a moderately or highly expressed gene, often exceeds the copy number of DNA counterparts by several orders of magnitude, which allows an increased sensitivity of detection.

In this study, we performed BRAFV600E mutation analysis using formalin-fixed paraffin-embedded (FFPE) samples of thyroid tissues from 62 patients, using an mRNA-based mutation assay with improved sensitivity to clarify the diagnostic and prognostic relevance of the level of mutant BRAFV600E in relation to wildtype BRAF alleles at the mRNA level.

Methods

Patient samples and nucleic acid extraction

FFPE tissue samples from 62 patients were obtained from the Department of Pathology, 103 Military Hospital, Hanoi, Vietnam (Table S2). Multiple 10 μm-thickness sections that contain 10 mg of FFPE tissue were collected, then deparaffinized by mineral oil before extraction of nucleic acids. RNA was extracted using GenElute™ FFPE RNA Purification Kit (Sigma – Aldrich, Canada), and DNA was extracted using QIAamp DNA FFPE Tissue Kit (Qiagen, Germany), according to the manufacturers’ instructions. The nucleic acid concentration was determined using an ND-1000 spectrophotometer (NanoDrop, Walmington, DE). In-vitro transcribed mRNA of the mutated BRAFV600E variant (mutant mRNA) and wildtype BRAF (wildtype mRNA) was utilized for determination of the sensitivity of BRAFV600E mRNA-based mutation assay [16].

Overview of the mRNA-based mutation assay

The principle of Extendable Blocking Probe-Reverse Transcription (ExBP-RT) assay, which was recently developed in our laboratory [16], utilizes an extendable wildtype-blocking probe that competes with a mutation-specific primer for annealing and extension of the mutant and corresponding wildtype mRNA during reverse transcription (Fig. 1). This allows for mutation-specific reverse transcription and subsequent selective qPCR amplification of cDNA derived from mutated mRNA. Improvements to the original protocol include optimal design of the mutation-specific primer and a recently developed warmstart reverse transcriptase enzyme which is activated above 40 °C (Table S2). A slow cooling toward the optimal annealing temperature during reverse transcription ensures that correct priming at a higher temperature occurs temporally prior to any possible mispriming event (Fig. 1c, d). The mutated BRAFV600E mRNA template can thus, be selectively amplified in a highly specific RT-qPCR assay (Fig. 1e).

Fig. 1
figure 1

Overview of the BRAFV600E mRNA mutation detection assay. Mutant BRAFV600E mRNA was detected in a two-step qPCR reaction as follows: I) A mutation-specific reverse transcription, utilizing a warmstart reverse transcriptase that is activated at relatively high temperature (40o-50 °C), in combination with an extendable wildtype-blocking probe and a 5′-tailed BRAFV600E mutation-specific primer; II) selective qPCR amplification of cDNA derived from mutant BRAFV600E mRNA

Primer and probe design for the BRAFV600E mRNA-based mutation assay

In order to segregate mutant and wildtype mRNA transcripts during reverse transcription, we designed a mutation-specific primer (Fig. 1a) and an extendable wildtype-blocking probe (Fig. 1)b with a sequence of 12–14 nucleotides, complementary to the mutant and corresponding wildtype mRNA at the mutation site (5′- AGATTTCACTGTAG-3′). A 5′-tail consisting of 10 nucleotide sequence, unrelated to the target gene, was incorporated in the mutation-specific primer (5′-CTCTCCCGTTGATTTCTCTGTA-3′). The mutation-specific primer was also used as the reverse primer during qPCR, allowing for selective amplification of cDNA derived from mutant mRNA.

Two step RT-qPCR for detection of expressed BRAFV600E mutation

Reverse transcription was carried out in a 10 μl reaction containing 1X buffer, 1.875 U reverse transcriptase (WarmStart® Reverse Transcriptase, NEB, USA), 0.5 mM of each dNTP, 0.125 μM mutation-specific primer, 0.8 μM extendable wildtype-blocking probe, and mRNA template. The cDNA synthesis was performed at 50 °C for 5 min, after which, the temperature was gradually decreased to 40 °C, 1 °C per minute with a final enzyme inactivation step at 80 °C for 15 min. Following reverse transcription, 2 μl of cDNA was transferred to the qPCR reaction. qPCR was performed in duplicate using the Rotor Gene Q realtime detection system (Qiagen, Germany) in a 20 μl reaction containing 1x QuantiTect SYBR Green master mix (Qiagen), 0.8 μM forward primer (5′- CATGAAGACCTCACAGTAAA-3′), reverse primer (5′-CTCTCCCGTTGATTTCTCTGTA-3′), and 2 μl cDNA template. The cycling protocol included denaturation at 95 °C for 15 min, followed by 45 cycles of 94 °C for 15 s, 63 °C for 30 s and 72 °C for 30 s. A parallel wildtype BRAF SYBR qPCR was performed in duplicate to control for mRNA extraction, as well as for measurement of the wildtype BRAF mRNA level (forward primer: 5′- CATGAAGACCTCACAGTAAA-3′; and the reverse primer: 5′- GATTTCACTGTAGCTAGACC-3′).

Determination of the sensitivity for detection of BRAFV600E mRNA mutation

The sensitivity of the mRNA-based mutation assay for detecting mutant mRNA transcripts in a background of corresponding wildtype transcripts was determined by comparing the amount of PCR product formed in a first reaction containing 107 copies of in-vitro transcribed wildtype BRAF mRNA as a template, with the amount of PCR product created in a second reaction containing the same amount of transcribed mutant BRAFV600EmRNA. The threshold cycle value (Ct value) was identified automatically during qPCR amplification by the Rotor Gene Q system (Qiagen, Germany). The ratio of products formed in the first reaction and second reaction were determined by quantitative PCR based on the difference in Ct values derived from the two reactions (∆Ctwt-mt = Ctwildtype − Ctmutant). The sensitivity of the mRNA-based mutation assay for BRAFV600E mutation, expressed as percentage, was calculated as 2-∆Ct × 100%, which corresponds to the lowest fraction of mutant transcripts to be detected as a distinct signal in a background signal derived from cross-priming of the wildtype template.

DNA sequencing

DNA extracted from clinical FFPE samples were amplified by PCR in 20 μl reactions of Kapa HiFi HotStart ReadyMix (Kapa Biosystems, USA) containing 1X buffer, 0.5 μM forward primer (5′-CATGAAGACCTCACAGTAAA-3′), 0.5 μM reverse primers (5′- ACTGTTCAAACTGATGGGACCCAC − 3′), and DNA template. PCR was performed by denaturation at 95 °C for 5 min, followed by 40 cycles of 98 °C for 30 s, 60 °C for 30 s, 72 °C for 30 s with a final extension at 72 °C for 1 min, using a conventional PCR thermal cycler Eppendorf vapo.protect (Eppendorf, Germany). PCR products were purified by ExoSAP-IT® PCR Product Cleanup (Affimetrix, USA) and subsequently subjected to Sanger sequencing using ABI 3130xl Genetic Analyzer system (Applied Biosystem, USA) with the reverse primer as sequencing primer.

Statistical analysis

Cohen’s Kappa coefficient and McNemar’s chi-square tests were used to compare the performance of two tests, mRNA-based mutation assay and Sanger sequencing method.

Results

Patient samples

Sixty-two patients were included in the study. Thirty-two of these had been diagnosed with thyroid cancer and 30 patients with benign thyroid disease. Out of the 32 thyroid carcinoma samples, 24 (75%) were papillary thyroid cancer (Table 1 and Table S1). Ethics approval and consent to participate in the study was obtained in accordance with the Declaration of Helsinki.

Table 1 Clinicopathologic parameters in patients with thyroid diseases

Sensitivity of the BRAFV600E mRNA mutation detection assay

The sensitivity of mRNA-based mutation assay was determined using in vitro transcribed mutant BRAFV600E and corresponding wildtype BRAF mRNA as templates (Fig. 2). The amplification product derived from qRT-PCR amplification of 107 copies of the mutant BRAFV600E mRNA was detected 14.67 cycles earlier than the amplification product derived from wildtype BRAF mRNA. The signal generated from the amplification of wildtype BRAF mRNA represents the cross-priming of mutation-specific primer to the wildtype BRAF mRNA template. The difference in threshold values, delta Ct, thus corresponds to a cross-priming efficiency of approximately 0.005% of the specific priming efficiency (2-∆Ct × 100% = 2–14.67 × 100%). As a result, the mRNA-based mutation assay can detect the BRAFV600E mutation in mRNA with frequency of 0.01%, or in other words, in the presence of a 10,000-fold excess of the wildtype BRAF counterpart.

Fig. 2
figure 2

Detection sensitivity for BRAFV600E mutation in mRNA. The sensitivity of a novel mRNA based mutation assay for BRAFV600E was determined using 107 copies of in vitro transcribed mRNA containing the BRAFV600E mutation and the same amount of corresponding wildtype mRNA as templates: a Amplification signal from mutant BRAFV600E mRNA (red line), wildtype BRAF mRNA (blue line) and no-template control-NTC (green line); b) Corresponding melting peaks of the amplification products

Detection of the BRAFV600E mutation in mRNA and DNA from benign and malignant thyroid FFPE tissue samples

The clinical applicability of the mRNA-based mutation assay for BRAFV600E mRNA was evaluated by analyzing nucleic acids isolated from FFPE tissue samples of thyroid tumors and non-malignant thyroid disease, and comparing results with direct sequencing (Fig. 3). BRAFV600E mRNA was detected in 18 out of 32 thyroid cancer samples (56.3%) with the BRAFV600E mRNA based mutation assay. In comparison, BRAFV600E DNA was detected by Sanger sequencing in only 13 (40.6%) of these 18 samples (Fig. 4). The presence of BRAFV600E mRNA could be confirmed in all 13 FFPE samples in which the mutation was detected by in DNA, by Sanger sequencing. The Cohen’s Kappa coefficient of 0.695 reveals the substantial agreement between the current mRNA-based mutation assay and Sanger sequencing method, in detecting the BRAFV600E mutation in thyroid cancer tissue samples. On the other hand, the McNemar’s chi-square test shows a two-tailed P value of 0.0736, suggesting a borderline significant difference between two tests in the detection of the BRAFV600E mutation. No BRAFV600E mutation was detected either in mRNA by the BRAFV600E mRNA-based mutation assay, or in DNA by Sanger sequencing, in any of the 30 FFPE samples of benign thyroid tissues, indicating a high specificity of both assays.

Fig. 3
figure 3

Detection of BRAFV600E mutation in mRNA from clinical FFPE samples. BRAFV600E mRNA based mutation assay was utilized for ultrasensitive detection of the BRAFV600E mutation in mRNA isolated from clinical FFPE specimens of thyroid cancer and non-malignant thyroid disease. a Amplification signals from a sample containing mutant BRAFV600E mRNA (B7020 - red line), a sample without mutant BRAFV600E mRNA (B6659 - blue line) and no-template control (NTC - green line); b Corresponding melting peaks of the amplification products

Fig. 4
figure 4

Detection of the BRAFV600E mutation in FFPE samples using DNA sequencing. Sanger DNA sequencing was used as a reference method to detect the BRAFV600E mutation in clinical FFPE specimens from patients with thyroid cancer and non-malignant thyroid disease. a Sequencing chromatogram showing two peaks (red and green) at the nucleotide position of interest for a sample with the BRAFV600E mutation (B7020), and b single peak (red) for a sample with wild type BRAF only (B6659)

Determination of relative expression levels of the BRAFV600E mRNA versus wildtype BRAF mRNA

We further investigated the allele-specific expression of the mutant and wildtype alleles of the BRAF gene in the 13 thyroid cancer tissue samples with BRAFV600E mutation detected in both DNA and mRNA (Table S1). The relative abundance of mutant versus wildtype alleles at the DNA levels was estimated using the peak heights (H) at the nucleotide position of interest (1799 T > A) on a direct sequencing chromatogram: RDNA = HBRAFV600E / HBRAFwildtype. Similarly, the relative abundance of mutant versus wildtype alleles at the mRNA levels was estimated using the delta Ct value (ΔCt) between the mutant and wildtype signals in mRNA-based mutation assays: RRNA = 1/2ΔCt(BRAFV600E-BRAFwildtype). The relative abundance of the mutated BRAFV600E allele in DNA was relatively constant, in the range 0.170–0.703. On the mRNA levels, however, the relative abundance of the mutated BRAFV600E alleles varied in the range of 0.001–0.429. The observed log (RRNA/RDNA) ratio was in the range − 2.48 - 0.35, corresponding to almost 3 log differences in expression levels of the mutated BRAFV600E alleles versus the wildtype BRAF counterparts in these tissue samples.

Discussion

In spite of functional genomics being an appealing approach for studying the relationship between genes and diseases, there is currently no data available regarding the specific mRNA expression of the BRAFV600E mutation in different cancer tissues. Many papillary thyroid cancers possess a mutated BRAF gene, most commonly the point mutation T1799A or BRAFV600E, which activates the MAPK pathway causing a loss of control of cellular proliferation, triggering the oncogenesis of thyroid gland [6, 17, 18]. We detected BRAFV600E mutations on the mRNA level in 56,3% (18/32) and on the DNA level in 40,6% (13/32) of thyroid cancer patients, which is roughly in concordance with the prevalence reported by a number of studies [2, 19,20,21,22]. The mRNA-based mutation detection assay, thus contributed to a 28% improvement in the sensitivity of detection, whereas the specificity of both the mRNA- and DNA-based assays was 100%. According to a number of studies, the prognostic relevance of BRAFV600E mutation still remains controversial in papillary thyroid carcinoma [23,24,25,26]. While the BRAFV600E mutation is not an independent predictor of poor outcome, the presence of the mutation is valuable for determining whether certain high-risk patients, in a relapse or primary metastatic setting, could be eligible for targeted BRAF inhibitor therapy with any of the currently available drugs, such as lenvatinib, vemurafenib or sorafenib [27]. Also, the presence of the BRAFV600E mutation in the primary tumor tissue opens possibilities for monitoring of the disease using liquid biopsy techniques.

Sanger sequencing is currently considered as the gold standard for point mutation detection, primarily due to the possibility to analyze a multitude of different mutations simultaneously. Drawbacks of this method are a relatively long, 2–3 day turn-around time as well as a relatively low sensitivity, limiting the detection of mutated alleles below a frequency of 7–20% [9]. Subsequently, a significant number of low-level mutations will remain undetected primarily due to tumor tissue heterogeneity and a relatively low frequency of mutated alleles. In our study, Sanger sequencing failed to detect the BRAFV600E mutation in 5 out of 18 samples, which were positive with BRAFV600E mRNA. BRAFV600E mRNA should, by definition, only be detected in a subgroup of patients haboring BRAFV600E mutation in DNA. In spite of this, the novel mRNA-based assay detected BRAFV600E mutations at a higher frequency than Sanger sequencing in FFPE samples from the same cohort of thyroid cancer patients. We speculate that this discrepancy might partially be explained by the superior technical sensitivity of the mRNA-based assay compared to direct sequencing, but also by the higher copy number of BRAFV600E mRNA transcripts in comparison to that of BRAFV600E DNA in thyroid cancer cells.

We also analyzed the relative level of the mutant BRAFV600E allele in the thyroid cancer FFPE tissue samples separately on the DNA and mRNA expression level. On the DNA level the relative abundance of BRAFV600E versus wildtype BRAF ranged between 0.170–0.703, while the variation in the relative abundance of the respective alleles was much wider on the mRNA level, in the range of about 3 logs (0.001–0.429). This suggests that the expression level of the BRAFV600E gene can be highly variable in thyroid cancer and maybe in other cancers as well. The level of BRAFV600E mRNA expression can to some extent be predictive of the subsequent expression of a mutant protein, and this may provide some insights to the role of BRAF mutations in cancer progression and prognosis. Nevertheless, the number of mRNA copies does not always reflect the functional protein expression level due to several post-transcriptional factors. A challenge for gene expression studies on mutation-dependent diseases is to innovate and implement integrative methodologies to analyze mRNA/protein expression in parallel.

Mutation detection at the mRNA level benefits from a higher copy number of mutated mRNA transcripts per cancer cell compared to the number of mutated DNA copies. Detection of the BRAFV600E mutations in mRNA without prior amplification has been demonstrated using a nanomechanical sensor comprising of microcantilever arrays coated with titanium and gold in combination with with a probe oligonucleotide and non-specific reference oligonucleotides [28]. This ultrasensitive device enables detection of mRNA at a concentration of 20 ng/μl and recognition of mutated BRAF DNA in a 50-fold excess of the wildtype background. In addition, there have been several improvements to previously existing amplification technologies, most recently by using artificial mismatched nucleotides on allele-specific primers to improve segregation between the respective alleles and externally added controller sequences [29]. Many other sensitive mutation detection assays based on the principle of allele-specific PCR have been described [30,31,32]. All of these technologies are, however, hampered by cross priming during amplification, leading to a decay in the discriminating power during the amplification process [33, 34]. The rate of cross-priming is dependent on the nucleotide used for discrimination between the alleles. In particular, PCR product yields have been shown to decrease by 20-fold for A:A mismatches, whereas mismatches involving T have minimal effect on PCR product yield [35]. Therefore, the design of AS-PCR assays for detection of the BRAFV600E (1799 T > A) mutation, which involves A:A or T:T mismatches, is inherently challenging, restricting assay sensitivity to about 0.1% at best [12, 13, 21, 36,37,38,39]. In contrast, the ExBP-RT technique used in this study discriminates between wild type and mutant alleles during a single cycle of reverse transcription, completely eliminating the problem of decay of sensitivity during subsequent qPCR amplification [16].

Conclusions

In conclusion, we have successfully established a novel assay for ultrasensitive detection and quantification of the BRAFV600E mRNA in FFPE tissue from thyroid cancer. This assay not only reveals the presence of the BRAFV600E mutation, but also the level of the mutated BRAFV600E mRNA. This approach opens new possibilities to study the functional consequences of mRNA expression of mutated genes and the potential clinical utility of mutation detection in mRNA, as a novel biomarker in various types of cancer and genetic diseases.

Availability of data and materials

The datasets used and/or analysed during the current study available from the corresponding author on reasonable request.

Abbreviations

BRAF:

V-raf murine sacoma viral oncogene homolog B

ExBP-RT:

Extendable blocking probe –reverse transcription

FFPE samples:

Formalin-fixed paraffin-embeded samples

IHC:

Immunohistochemistry

MAPK:

Mitogen-activated protein kinase

References

  1. GLOBOCAN. 2018. https://gco.iarc.fr/.

  2. Trovisco V, Soares P, Sobrinho-Simoes M. B-RAF mutations in the etiopathogenesis, diagnosis, and prognosis of thyroid carcinomas. Hum Pathol. 2006;37(7):781–6.

    Article  CAS  PubMed  Google Scholar 

  3. Tan YH, Liu Y, Eu KW, Ang PW, Li WQ, Salto-Tellez M, et al. Detection of BRAF V600E mutation by pyrosequencing. Pathology. 2008;40(3):295–8.

    Article  CAS  PubMed  Google Scholar 

  4. Sithanandam G, Kolch W, Duh FM, Rapp UR. Complete coding sequence of a human B-raf cDNA and detection of B-raf protein kinase with isozyme specific antibodies. Oncogene. 1990;5(12):1775–80.

    CAS  PubMed  Google Scholar 

  5. Sithanandam G, Druck T, Cannizzaro LA, Leuzzi G, Huebner K, Rapp UR. B-raf and a B-raf pseudogene are located on 7q in man. Oncogene. 1992;7(4):795–9.

    CAS  PubMed  Google Scholar 

  6. Davies H, Bignell GR, Cox C, Stephens P, Edkins S, Clegg S, et al. Mutations of the BRAF gene in human cancer. Nature. 2002;417(6892):949–54.

    Article  CAS  PubMed  Google Scholar 

  7. Xing M. Genetic-guided risk assessment and Management of Thyroid Cancer. Endocrinol Metab Clin N Am. 2019;48(1):109–24.

    Article  Google Scholar 

  8. Su X, Jiang X, Xu X, Wang W, Teng X, Shao A, et al. Diagnostic value of BRAF (V600E)-mutation analysis in fine-needle aspiration of thyroid nodules: a meta-analysis. Onco Targets Ther. 2016;9:2495–509.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  9. Oh HS, Kwon H, Park S, Kim M, Jeon MJ, Kim TY, et al. Comparison of immunohistochemistry and direct sanger sequencing for detection of the BRAF(V600E) mutation in thyroid neoplasm. Endocrinol Metab. 2018;33(1):62–9.

    Article  CAS  Google Scholar 

  10. Laurini JA, Aoun P, Iqbal J, Chan W, Greiner TC. Investigation of the BRAF V600E mutation by pyrosequencing in lymphoproliferative disorders. Am J Clin Pathol. 2012;138(6):877–83.

    Article  PubMed  Google Scholar 

  11. Sapio MR, Posca D, Troncone G, Pettinato G, Palombini L, Rossi G, et al. Detection of BRAF mutation in thyroid papillary carcinomas by mutant allele-specific PCR amplification (MASA). Eur J Endocrinol. 2006;154(2):341–8.

    Article  CAS  PubMed  Google Scholar 

  12. Pichler M, Balic M, Stadelmeyer E, Ausch C, Wild M, Guelly C, et al. Evaluation of high-resolution melting analysis as a diagnostic tool to detect the BRAF V600E mutation in colorectal tumors. The Journal of molecular diagnostics : JMD. 2009;11(2):140–7.

    Article  CAS  PubMed  Google Scholar 

  13. Pinzani P, Santucci C, Mancini I, Simi L, Salvianti F, Pratesi N, et al. BRAFV600E detection in melanoma is highly improved by COLD-PCR. Clinica chimica acta; international journal of clinical chemistry. 2011;412(11–12):901–5.

    Article  CAS  PubMed  Google Scholar 

  14. Long GV, Wilmott JS, Capper D, Preusser M, Zhang YE, Thompson JF, et al. Immunohistochemistry is highly sensitive and specific for the detection of V600E BRAF mutation in melanoma. Am J Surg Pathol. 2013;37(1):61–5.

    Article  PubMed  Google Scholar 

  15. Cheng L, Lopez-Beltran A, Massari F, MacLennan GT, Montironi R. Molecular testing for BRAF mutations to inform melanoma treatment decisions: a move toward precision medicine. Modern pathology : an official journal of the United States and Canadian Academy of Pathology, Inc. 2018;31(1):24–38.

    Article  CAS  Google Scholar 

  16. Ho TH, Dang KX, Lintula S, Hotakainen K, Feng L, Olkkonen VM, et al. Extendable blocking probe in reverse transcription for analysis of RNA variants with superior selectivity. Nucleic Acids Res. 2015;43(1):e4.

    Article  PubMed  CAS  Google Scholar 

  17. Cohen Y, Xing M, Mambo E, Guo Z, Wu G, Trink B, et al. BRAF mutation in papillary thyroid carcinoma. J Natl Cancer Inst. 2003;95(8):625–7.

    Article  CAS  PubMed  Google Scholar 

  18. Deichmann M, Thome M, Benner A, Naher H. B-raf exon 15 mutations are common in primary melanoma resection specimens but not associated with clinical outcome. Oncology. 2004;66(5):411–9.

    Article  CAS  PubMed  Google Scholar 

  19. Fukushima T, Suzuki S, Mashiko M, Ohtake T, Endo Y, Takebayashi Y, et al. BRAF mutations in papillary carcinomas of the thyroid. Oncogene. 2003;22(41):6455–7.

    Article  CAS  PubMed  Google Scholar 

  20. Czarniecka A, Oczko-Wojciechowska M, Barczynski M. BRAF V600E mutation in prognostication of papillary thyroid cancer (PTC) recurrence. Gland surgery. 2016;5(5):495–505.

    Article  PubMed  PubMed Central  Google Scholar 

  21. Jeong D, Jeong Y, Lee S, Lee H, Lee W, Kim H, et al. Detection of BRAF(V600E) mutations in papillary thyroid carcinomas by peptide nucleic acid clamp real-time PCR: a comparison with direct sequencing. Korean journal of pathology. 2012;46(1):61–7.

    Article  PubMed  PubMed Central  Google Scholar 

  22. Kimura ET, Nikiforova MN, Zhu Z, Knauf JA, Nikiforov YE, Fagin JA. High prevalence of BRAF mutations in thyroid cancer: genetic evidence for constitutive activation of the RET/PTC-RAS-BRAF signaling pathway in papillary thyroid carcinoma. Cancer Res. 2003;63(7):1454–7.

    CAS  PubMed  Google Scholar 

  23. Gandolfi G, Sancisi V, Piana S, Ciarrocchi A. Time to re-consider the meaning of BRAF V600E mutation in papillary thyroid carcinoma. Int J Cancer. 2015;137(5):1001–11.

    Article  CAS  PubMed  Google Scholar 

  24. Damiani L, Lupo S, Rossi R, Bruni S, Bartolomei M, Panareo S, et al. Evaluation of the role of BRAFV600E somatic mutation on papillary thyroid Cancer disease persistence: a prospective study. European thyroid journal. 2018;7(5):251–7.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  25. Yan C, Huang ML, Li X, Wang T, Ling R. Relationship between BRAFV600E and clinical features in papillary thyroid carcinoma. Endocrine connections. 2019.

  26. Russo M, Malandrino P, Nicolosi ML, Manusia M, Marturano I, Trovato MA, et al. The BRAF(V600E) mutation influences the short- and medium-term outcomes of classic papillary thyroid cancer, but is not an independent predictor of unfavorable outcome. Thyroid : official journal of the American Thyroid Association. 2014;24(8):1267–74.

    Article  CAS  Google Scholar 

  27. Crispo F, Notarangelo T, Pietrafesa M, Lettini G, Storto G, Sgambato A, et al. BRAF Inhibitors in Thyroid Cancer: Clinical Impact, Mechanisms of Resistance and Future Perspectives. Cancers. 2019;11:9.

    Article  CAS  Google Scholar 

  28. Huber F, Lang HP, Backmann N, Rimoldi D, Gerber C. Direct detection of a BRAF mutation in total RNA from melanoma cells using cantilever arrays. Nat Nanotechnol. 2013;8(2):125–9.

    Article  CAS  PubMed  Google Scholar 

  29. Yang Z, Zhao N, Chen D, Wei K, Su N, Huang JF, et al. Improved detection of BRAF V600E using allele-specific PCR coupled with external and internal controllers. Sci Rep. 2017;7(1):13817.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  30. Toni TA, Brenner BG, Asahchop EL, Ntemgwa M, Moisi D, Wainberg MA. Development of an allele-specific PCR for detection of the K65R resistance mutation in patients infected with subtype C human immunodeficiency virus type 1. Antimicrob Agents Chemother. 2010;54(2):907–11.

    Article  CAS  PubMed  Google Scholar 

  31. Wu DY, Ugozzoli L, Pal BK, Wallace RB. Allele-specific enzymatic amplification of beta-globin genomic DNA for diagnosis of sickle cell anemia. Proc Natl Acad Sci U S A. 1989;86(8):2757–60.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  32. Rowley CF, Boutwell CL, Lee EJ, MacLeod IJ, Ribaudo HJ, Essex M, et al. Ultrasensitive detection of minor drug-resistant variants for HIV after nevirapine exposure using allele-specific PCR: clinical significance. AIDS Res Hum Retrovir. 2010;26(3):293–300.

    Article  CAS  PubMed  Google Scholar 

  33. Chen X, Sullivan PF. Single nucleotide polymorphism genotyping: biochemistry, protocol, cost and throughput. Pharm J. 2003;3(2):77–96.

    Google Scholar 

  34. Giffard PM. Comparison of competitively primed and conventional allele-specific nucleic acid amplification. Anal Biochem. 2001;292(2):207–15.

    Article  CAS  PubMed  Google Scholar 

  35. Kwok S, Kellogg DE, McKinney N, Spasic D, Goda L, Levenson C, et al. Effects of primer-template mismatches on the polymerase chain reaction: human immunodeficiency virus type 1 model studies. Nucleic Acids Res. 1990;18(4):999–1005.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  36. Huang T, Zhuge J, Zhang WW. Sensitive detection of BRAF V600E mutation by amplification refractory mutation system (ARMS)-PCR. Biomarker research. 2013;1(1):3.

    Article  PubMed  PubMed Central  Google Scholar 

  37. Morandi L, de Biase D, Visani M, Cesari V, De Maglio G, Pizzolitto S, et al. Allele specific locked nucleic acid quantitative PCR (ASLNAqPCR): an accurate and cost-effective assay to diagnose and quantify KRAS and BRAF mutation. PLoS One. 2012;7(4):e36084.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  38. Lee ST, Kim SW, Ki CS, Jang JH, Shin JH, Oh YL, et al. Clinical implication of highly sensitive detection of the BRAF V600E mutation in fine-needle aspirations of thyroid nodules: a comparative analysis of three molecular assays in 4585 consecutive cases in a BRAF V600E mutation-prevalent area. J Clin Endocrinol Metab. 2012;97(7):2299–306.

    Article  CAS  PubMed  Google Scholar 

  39. Chat-Uthai N, Vejvisithsakul P, Udommethaporn S, Meesiri P, Danthanawanit C, Wongchai Y, et al. Development of ultra-short PCR assay to reveal BRAF V600 mutation status in Thai colorectal cancer tissues. PLoS One. 2018;13(6):e0198795.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

Download references

Acknowledgements

We thank Trieu Thi Nguyet, Vu Nguyen Quynh Anh, Pham Van Quyen, Dang The Tung, Pham Chau for excellent technical assistance and Pham The Tai, Dang Thanh Chung, Tran Ngoc Dung, Dinh Thi Thu Hang, Nguyen Sy Lanh for their helpful support and discussion.

Funding

This work was funded by Vietnam National Foundation for Science and Technology Development (NAFOSTED) under grant number 106-YS.06–2016.16. The funders has no role in the study design; the collection, analysis, and interpretation of data; the writing of the manuscript; or the decision to submit the article for publication.

Author information

Authors and Affiliations

Authors

Contributions

All authors read and approved the final manuscript. T.H.H and J. S supervised the work. T.H.H, T.V.T, Q.H.P and U.D.N designed the experiments. T.V.T, K.X.D, Q.H.P, U.D.N, B.V.N, D.T.N., L.V.H, S.A.H, D.T.T, T.H.H, and D.N.T performed the experiments. T.V.T, K.X.D, Q.H.P, A. O, U. S, T.H.H, and N.T.T.T analyzed the data. Q.H.P, K.X.D, N.T.T.T, L.V.H, S.A.H, B.V.N, D.T.N, A. O, U. S, J. S, aand T.H.H wrote the paper.

Corresponding author

Correspondence to Tho Huu Ho.

Ethics declarations

Ethics approval and consent to participate

The use of the clinical samples for this study was approved by the Ethics Committee of the Vietnam Military Medical University according to the Declaration of Helsinki. Consent was provided by all participants orally and their specimens were allowed to be stored in the hospital database and used in research through a written document (N°: XN28/BV103). Patients records were anonymized and contained no identifiable traits.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

Additional file 1: Table S1.

Clinicopathologic and molecular data of novel mRNA-based assay and Sanger sequencing for BRAFV600E expression of thyroid cancer cases. 

Additional file 2: Table S2.

 Improvements of current mRNA-based mutation assay in comparison to the original assay of Extendable blocking probe - reverse transcription (ExBP-RT).

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Tran, T.V., Dang, K.X., Pham, Q.H. et al. Evaluation of the expression levels of BRAFV600E mRNA in primary tumors of thyroid cancer using an ultrasensitive mutation assay. BMC Cancer 20, 368 (2020). https://doi.org/10.1186/s12885-020-06862-w

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s12885-020-06862-w

Keywords