Constitutive phosphorylation of the FOXO1 transcription factor in gastric cancer cells correlates with microvessel area and the expressions of angiogenesis-related molecules

Patients and Samples

The files of 272 surgically resected gastric cancer cases examined at the Department of Pathology, Seoul National University College of Medicine from 1 January to 30 June 1995 were analyzed. Age, sex, tumor location and pTNM stage were evaluated by reviewing the medical records and pathological reports [15]. The mean age of the patients was 54.8 years, and 93.3% of the patients had undergone curative resection. The cases enrolled in this study included 193 advanced and 79 early gastric carcinomas. According to the UICC criteria, there were 112 cases in stage I, 53 cases in stage II, 63 cases in stage III, and 44 cases in stage IV. No patient had received preoperative chemotherapy or radiotherapy. Glass slides were reviewed to determine histological type according to the WHO and Lauren's classification. his series included 102 intestinal types, 166 diffuse types, and 4 mixed types. Clinical outcomes were followed from the date of surgery to either the date of death or December 1^st, 2000, resulting in the follow-up period ranged from 1 month to 72 months (mean, 51 months). Cases lost to follow up and those resulting in death from any cause other than gastric cancer were censored for survival rate analysis. This protocol was reviewed and approved by the Institutional Review Board of Seoul National University (Approval No. C-0511-519-163).

Tissue array methods

Six array blocks obtained from patients with a gastric cancer were prepared as described previously (Superbiochips Laboratories, Seoul, Korea) [16]. Briefly, core tissue biopsies (2 mm in diameter) were taken from individual paraffin-embedded gastric tumors (donor blocks) and arranged in the new recipient paraffin blocks (tissue array block) using a trephine apparatus. As we have reported previously [16], the staining results of the different intratumoral areas of gastric carcinomas in these tissue array blocks showed an excellent agreement. A core was chosen from each case for analysis. We defined an adequate case as a tumor occupying more than 10% of the core area. Sections of 4 μm thickness were cut from each tissue array block, deparaffinized, and dehydrated.

Immunohistochemistry

Immunohistochemical staining was performed as described previously using a streptavidin peroxidase procedure (avidin-biotin complex method) after antigen retrieval using an autoclave [17]. Anti-phospho-Ser256-FOXO1 (1:50) from Cell Signaling Technology (Beverly, MA, USA) was used as the primary antibody. Other primary antibodies used were anti-CD34 (1:300, Immunotech, Cedex, France), anti-HIF-1α (donated by JW Park at SNU, Seoul, Korea), anti-VEGF (1:250, Santa Cruz Biotechnology, Santa Cruz, CA, USA), anti-phospho-Ser473-AKT (1:100, New England Biolabs, Beverly, MA, USA), anti-NF-κB p65 (1:50, Santa Cruz Biotechnology), anti-phospho-Tyr705-STAT3 (1:50, Cell Signaling Technology) and anti-β-catenin (1:200, Transduction, Lexington, KY, USA). The results of immunostaining were evaluated by two pathologists (JHK and MSC), who were blinded to the origin of the samples. The concordance rates were generally high ranging from 75.7% (κ = 0.328, P < 0.001) to 87.5% (κ = 0.591, P < 0.001). Discrepancies were resolved by reaching consensus. For statistical analysis, the results of immunostaining for proteins were considered positive if immunoreactivity was seen in ≥ 10% (cytoplasmic pFOXO1, cytoplasmic VEGF, cytoplasmic and nuclear pAKT, nuclear NF-κB and nuclear β-catenin), ≥ 5% (nuclear HIF-1α) or ≥ 1% (nuclear pSTAT3) of the neoplastic cells.

Evaluation of microvessel area (MVA)

Vessel areas immunostained with an anti-CD34 antibody in gastric cancer specimens were determined as described previously [17]. Tissue sections were examined by two independent observers (SYK and JY). Briefly, the three most highly vascularized areas in areas of tumor sections were selected under × 100 magnification and photographs of CD34-immunopositive microvessel vessels in tumor sections were taken under × 200 magnification using light microscopy. The cross-sectional areas of CD34-immunopositive structures (i.e. MVA) were quantified by capturing images, converting them to gray scale and analyzing CD34-stained areas using NIH Image Analysis software (version 1.62; National Institute of Health, Bethesda, MD, USA) after setting one consistent intensity threshold for all slides. Then, CD34-positive areas were expressed as pixels squared per high-power field.

Cell culture

A human gastric cancer cell line SNU-638 was obtained from the Korean Cell Line Bank (Seoul, Korea), cultured in RPMI-1640 medium (Life Technologies, Grand Island, NY, USA) containing 10% fetal bovine serum (Life Technologies), and maintained in a 37°C humidified incubator containing 95% air and 5% CO₂. To examine the effect of FOXO1 suppression on HIF-1α expression, cells were incubated under either normoxic or hypoxic conditions.

Lentivirus-mediated shRNA silencing of FOXO1

FOXO1 shRNA lentiviral particles and non-targeting shRNA control particles were purchased (Sigma, St Louis, MO, USA). The sequence of the shRNA targeting FOXO1 used in the present study is the following: CCGGGCCTGTTATCAATCTGCTAAACTCGAGTTTAGCAGATTGATAACAGGCTTTTTG. The non-targeting shRNA control particles contain 4 basepair mismatches within the short hairpin sequence to any known human or mouse gene. The viral infection was performed by incubating SNU-638 gastric cancer cells in the culture medium containing lentiviral particles for 12 h in the presence of 5 μg/ml Polybrene (Santa Cruz Biotechnology). Pooled puromycin (2 μg/ml)-resistant cells were harvested and stored for further analysis.

Western blotting

Cell lysates were prepared in 100-200 μl of 1 × SDS lysis buffer [125 mM Tris-HCl (pH 6.8), 4% SDS, 0.004% bromophenol blue, and 20% glycerol] and then boiled for 10 min. Protein contents were measured using BCA Protein Assay Reagent (Pierce, Rockford, IL, USA). Samples were diluted with 1 × lysis buffer containing 1.28 M β-mercaptoethanol, and equal amounts of protein were loaded onto 8-12% SDS-polyacrylamide gels. Proteins were electrophoretically transferred to PVDF or nitrocellulose membranes, and membranes were then blocked with 5% nonfat dry milk in PBS/Tween-20 (0.1%, vol/vol) at 4°C overnight. They were then incubated with a primary antibody against FOXO1 (1:1000; Cell Signaling Technology), HIF-1α (1:1000; donated by JW Park), or β-actin (1:1000; Sigma) for 2 h. They were then incubated with a corresponding secondary antibody, either horseradish peroxidase-conjugated anti-rabbit IgG (1:2000; Zymed, San Francisco, CA, USA) or anti-mouse IgG (1:2500; Santa Cruz Biotechnology) for 2 h, and enhanced chemiluminescence (ECL) (Amersham Biosciences, Arlington Heights, IL, USA) was used for the visualization of the immunoreactive proteins. Equal loading of the protein was confirmed by β-actin.

Semiquantitative reverse transcription-polymerase chain reaction (SQ RT-PCR)

To quantify mRNA levels, we used a highly sensitive, SQ RT-PCR method. Total RNAs were isolated using TRIZOL reagent purchased from Invitrogen (Carlsbad, CA, USA), and 1 μg of RNAs were reverse-transcribed at 48°C for 30 min. Complementary DNAs were amplified over 18 PCR cycles (94°C for 30 sec, 52°C for 30 sec, and 70°C for 30 sec) in a reaction mixture containing 5 mCi (α-³²P)dCTP (NEN, Boston, MA, USA). The resulting PCR fragments (5 ml) were electrophoresed on a 2% agarose gel at 100 V in 1 × TAE, and the gels were dried and autoradiographed. Primer sequences were 5'-CCCCAGATTCAGGATCAGACA-3' and 5'-CCATCATGTTCCATTTTTCGC-3' for HIF-1α, and 5'-ACACCTTCTACAATGAGCTG-3' and 5'-CATGATGGAGTTGAAGGTAG-3' for β-actin.

Statistical analysis

All statistical analyses were conducted using SPSS version 11.0 software (SPSS, Chicago, IL, USA). The significance of correlation between the expressions of pFOXO1 and other proteins was determined by the chi-squared test. MVAs were expressed as means ± S.D. and the relationship between pFOXO1 expression and MVA was analyzed using the two-tailed Student's t-test. Survival curves were estimated using the Kaplan-Meier product-limit method, and the significance of differences between the survival curves was determined using the log-rank test. Regarding the survival curve, the MVA score was considered positive when the value was higher than the mean value and vice versa. P < 0.05 was considered significant.

Expressions of pFOXO1 and angiogenesis-related proteins in gastric cancer specimens

Immunohistochemical staining was used to investigate the correlation between pFOXO1 expression and angiogenesis in gastric cancer. Figure 1 shows representative immunohistochemical features of proteins in gastric cancer tissues. pFOXO1 (Figure 1A and 1B) and HIF-1α (Figure 1E and 1F) were found to be expressed in both the nuclei and cytoplasm of tumor cells. Regarding pFOXO1 staining, cells showing distinct cytoplasmic staining, regardless of the presence of nuclear staining, were considered to express pFOXO1 constitutively, whereas those with nuclear HIF-1α expression, regardless of the presence of cytoplasmic staining, were considered to exhibit activated HIF-1α. Since immunostaining was performed with an antibody against an inactivated form of FOXO1 (pFOXO1), an increase in pFOXO1 expression was interpreted as a decrease in FOXO1 activation. Consequently, correlations between pFOXO1 and other proteins are opposite to those between activated FOXO1 and these proteins. Constitutive pFOXO1 expression was observed in 230 (85%) of the 272 gastric cancer cases examined.

Association between the expression of pFOXO1 and MVA

pFOXO1 expression and MVA in relation to prognosis

Our analysis of the 272 gastric cancer patients revealed that those with pFOXO1 expression had a significantly higher survival rate than those without pFOXO1 expression (P = 0.004) (Figure 2A). In our analysis of the combined status of the expression of pFOXO1 and MVA in relations to prognosis, patients with a pFOXO1-positive tumor and higher MVA had better outcome than patients with the other combinations (P = 0.025) (Figure 2B).

Correlation between the expression of pFOXO1 and the expression of angiogenic proteins in surgical gastric cancer samples

Correlations between pFOXO1 expression in tumor cells and MVA in HIF-1α-positive and HIF-1α-negative tumors and in VEGF-positive and VEGF-negative tumors

Effect of FOXO1 inhibition on the expression of HIF-1α in gastric cancer cells in vitro

HIF-1α has been reported to increase gastric tumor growth and angiogenesis [18]. Thus, we performed cell culture experiments to further examine the direct relationship between the expressions of FOXO1 and HIF-1α. FOXO1 expression was suppressed by transfecting FOXO1 shRNA into SNU-638 gastric cancer cells, and subsequently, cells were cultured under normoxic or hypoxic conditions. Western blot analysis showed that decreased FOXO1 expression increased HIF-1α protein expression under hypoxic conditions (Figure 3, upper), and RT-PCR showed that decreased FOXO1 expression increased HIF-1α mRNA expression under both normoxic and hypoxic conditions (Figure 3, lower). These results suggest that FOXO1 inhibits HIF-1α expression at the transcriptional level.