Clinical sample collection
Clinical data and cervical squamous cancer specimens were collected from Kashgar People’s Hospital, Xinjiang Tumor Hospital, the First Affiliated Hospital and the Third Affiliated Hospital of the Medical College of Shihezi University, Xinjiang, China from January 2008 to May 2019. Cervical cancer samples were collected from patients with different pathological grades. None of the patients received radiotherapy or chemotherapy prior to cervical tissue collection. All histological diagnoses were confirmed by the hospital’s experienced pathologists. Each patient provided written informed consent. The study was approved by the Ethics Committee of Shihezi University of Medicine College. Samples obtained included cervical squamous cell carcinoma tissue, normal cervical tissue and para-carcinoma tissue. Fresh tissue samples were frozen immediately after removal and stored at -80 °C.
Immunohistochemistry assay
Immunohistochemistry (IHC) staining was performed on 4 µm paraffin-embedded tissue specimens to detect protein expression levels of C/EBPβ, PCNA and Ki67. In short, formaldehyde fixed paraffin-embedded tissue and paired control tissue were sectioned at 4 µm. The sections were dewaxed for 25 min in xylene and rehydrated for 5 min in 100%, 95%, 80% and 70% ethanol. Antigen retrieval was carried out in 0.01 M citric acid buffer in the microwave for 3 min at high power followed by 10 min at low power. Slides were then incubated with 3% H2O2 at room temperature to block endogenous peroxidase activity. Slides were then washed in PBS solution and blocked with 10% goat serum (Zhong Shan Biotechnology, China) for 30 min. The slides were incubated overnight at 4 °C with rabbit anti-human C/EBPβ antibody (1:200; Millipore, USA), rabbit anti-human PCNA antibody (1:200; Millipore, USA), and rabbit anti-human Ki67 antibody (1:200; Millipore, USA). The slides were washed three times in PBS solution and incubated at room temperature with HRP-conjugated secondary antibodies for 30 min. All slides were dehydrated, chromogenically developed and counterstained with a solution of diaminobenzidine and 20% hematoxylin. IHC slides were reviewed and graded by two independent pathologists. Visual grading and stratification of staining intensity was performed on a scale of 0–3: Negative stain 0 (-), weak stain 1 ( +), moderate stain 2 (+ +), strong stain 3 (+ + +).
The cDNA synthesis and quantitative RT-PCR
According to the manufacturer’s instructions, 100 mg of total RNA was extracted from tissues using the miRNeasy Mini Kit (Qiagen, Germany). RNA was quantified using a NanoDrop™ 2000 spectrophotometer (Thermo Fisher Scientific, Inc.). The standards for acceptable RNA were a A260/A280 ratio of 1.8–2.0. The cDNA was obtained using poly (A) polymerase reverse transcriptase primers (miRcute miRNA First-Strand cDNA Synthesis Kit, Tiangen Biotech, Inc., Beijing, China) at 37 °C 60 min, followed by 4 °C. Quantitative RT-PCR (qRT-PCR) was performed using the SYBR® Green PCR Kit (Qiagen, Germany) using a real-time PCR detection system (ABI 7500, Life Technology, USA). qRT-PCR amplification was performed with a denaturing step (95 °C 15 min), followed by 40 cycles of 94 °C for 15 s, 55 °C for 30 s, and 72 °C for 15 s. GAPDH was used as an internal control to normalize gene expression. The GAPDH gene was selected from the verification method described earlier as an appropriate reference gene and was used to determine the ΔCt value. Changes in gene expression were calculated using the 2−ΔΔCt method. Gene expression results were analyzed based on the target gene/GAPDH ratio. The primers used were: C/EBPβ: F: 5′- CCTCGCAGGTCAAGAGCAAG -3′, R: 5′- GAACAAGTTCCGCAGGGTG -3′; GAPDH: F: 5′- TGTTGCCATCAATGACCCCTT -3′, R: 5′- CTCCACGACGTACTCAGCG -3′.
The qRT-PCR detection is performed at least three times.
Western blotting
After cell lysis, the cell lysates were incubated in a water bath for 5 min at 100 °C for protein denaturation, and then centrifuged for 10 min at 12,000 × g. Separation of equal volume supernatant in 10% sodium dodecyl sulfate was performed with polyacrylamide gel electrophoresis. The proteins were transferred to polyvinylidene difluoride membranes (Beijing Solar Photoelectric Technology Co., Ltd., Beijing, China) using a semi-dry transfer. Membranes were blocked using 5% skim milk for 2 h, followed by primary antibody incubations overnight at 4 °C. Membranes were washed with Tris-buffered saline and Tween 20 three times at room temperature for 10 min each wash. Secondary antibody was incubated on the membranes for 2 h and the membranes were washed three times with Tris-buffered saline and Tween 20 for 10 min each wash. Blots were then washed with deionized water for 5 min. Blots were incubated with use ECL Plus, and imaging was performed using the ChemiDoc XRS + System (Bio-Rad, Hercules, CA, USA). Primary antibody dilution were as follows: anti-C/EBPβ (rabbit; 1:1,000; catalog # E299), anti-MTA1 (rabbit; 1:1,000; catalog # D40D1), and anti-β-Actin (rabbit; 1:1,000; catalog # 4967). Antibodies were purchased from Cell Signaling Technology, Inc. (USA). Western blot experiments were repeated five times.
Cell culture and plasmid transfection
Human cervical cancer HeLa and SiHa cells were cultured in 10% fetal bovine serum (Sijiqing Technologies, Hangzhou, China), 100 U/mL penicillin and 100 mg/mL streptomycin (Solarbio, China) in Dulbecco’s Modified Eagle Medium (Gibco; Thermo Fisher Science, Inc., Waltham, VA, USA). Cells were kept at 37 °C in a humidified chamber containing 5% CO2. FuGENE HD (Roche Diagnostics) was used to transfect constructed plasmids into cell lines. The transfection mix was composed of 5 μl FuGENE HD, 2 μg plasmids, and 100 μl serum-free media. A 24-well plate was seeded with 1 × 105 cells and cultured in complete media. After reaching 80% confluency, the cells were rinsed with PBS. Transfected cells were not cultured in penicillin or streptomycin. The experiment was repeated three times.
Cell counting kit-8 assay
According to the manufacturer’s instructions, cells were inoculated into a 96-well plate at 5 × 103 cells/well and cultured for 0, 12, 24, 36, 48 and 72 h after transfection. Cell proliferation was recorded at each timepoint using the Cell Counting Kit-8 (CCK-8) assay (Dojindo, Tokyo, Japan) for 72 h. The absorbance at 450 nm was detected using a microplate reader (Bio-Rad, USA), 2 h after culturing in the incubator (37 °C, 5% CO2). Set 4 repeated holes at each point in time and repeated the experiment at least 3 times.
Colony formation assay
Cultured HeLa and SiHa cells were seeded into a 6-well plate at a concentration of 1 × 104 cells per well and incubated at 37 °C for 2 weeks. The plates were then washed two times with PBS for 5 min each, followed by a methanol fixation for 15 min. Plates were then stained for 15 min in PBS with 0.1% Crystal Violet. Cell colonies were counted if they had at least 50 cells. The experiment was repeated three times.
Cell cycle analysis
Cells were collected, washed with PBS, and fixed overnight in 70% ethanol at -20 °C. The ethanol-fixed cells were then pelleted, washed with ice-cold PBS, and then resuspended in 50 μg/mL propidium iodide (PI) and 100 μg/mL RNaseA. Cells were then cultured for 30 min at 37 °C. The cells were detected by flow cytometry. The percentage of cells in the G0-G1 phase, the S phase, and the G2 phase was analyzed. The experiment was repeated three times.
Transwell migration and invasion assay
Cell migration and invasion assays were assessed using a transwell plate containing 8 µm perforated membrane (Corning Corporation, Corning, New York, USA). Transfected cells were resuspended at 5 × 104 in serum-free medium and seeded into the upper chamber of the plate. Briefly, transfected cells were harvested, suspended in serum-free medium, and plated into the upper chamber for the migration or invasion assays, respectively. In addition, a culture base containing 20% fetal bovine serum was introduced into the lower chamber. Forty-eight hours after incubation at 37 °C, the cells in the upper chamber were removed. Cells on the lower surface were fixed and dyed, and the number of cells that had migrated or invaded in five random fields of view were measured using a microscope. The experiment was repeated three times.
Wound healing assay
Five straight lines, 1 cm apart, were drawn on the back of a 6-well plate. Cell lines (2.5 × 105 cells/ml in 2 mL) were added to the culture dish and cultured for 24 h. Scratches were made in the cell layer using 200 μL pipette tips perpendicular to five of the pre-drawn lines. The cells were washed with PBS and 2 mL of serum-free culture media were added to the wells. The migration of the cells at specified times (0, 24, and 48 h) was observed using an inverted microscope. The experiment was repeated three times.
Annexin V-PI double staining assay
Cells were transferred to a 1.5 mL centrifuge tube after transfection for 48 h. Cells were resuspended in 0.5 mL of binding buffer. Subsequently, 5 μL of PI and 5 μL of Annexin V-EGFP were added to the centrifuge tube. The cells were incubated for 15 min at 25 °C and then measured with a flow cytometer.
MassARRAY assay
DNA was extracted from tissue samples using the QIAamp DNA Mini Kit (Qiagen, Germany). Bisulfite was added to the EZ DNA Methylation Kit (Sequenom, USA). The PCR reaction was set up with a total volume of 5 μl and the following: 5 ng template, 0.5 U Hot Star Taq polymerase (Qiagen), forward and reverse primers, (0.5 μL, 10 pmol), 0.5 μL of 10 × PCR buffer, 0.4 μL of MgCl2, 0.5 μL of ddH2O, and 0.1 μL of 25 mM dNTP. PCR amplification consists of a denaturation step (95 °C for 15 min), followed by 45 cycles of 94 °C for 20 s, 62 °C for 30 s, 72 °C for 60 s, then 72 °C for 3 min. Shrimp alkaline phosphatase (2 μL) was then added to each reaction. The samples were centrifuged at 3,000 rpm for 5 min, cultured at 37 °C for 20 min, then 85 °C for 5 min. For the RNA transcription volume of 5 μL, the following were included: 0.89 μL of 5 × T cleavage & Polymerase Buffer, 3.15 μL of RNase-free ddH2O, 0.24 μL of T cleavage mix, 0.44 μL of T7 RNA & DNA polymerase, 0.06 μL of RNAase A, and 0.22 μL of 100 mM DTT. After incubating the samples for 3 h at 37 °C, 6 mg Clean Resin (Sequenom) was added to desalt the RNA.
Statistics assay
Statistical analysis was performed with SPSS 17.0 software. P < 0.05 signified statistical significance. Protein levels were compared between cervicitis tissues and cervical cancer tissues using non-parametric tests. MALDI-TOF MassARRAY data were analyzed using a Wilcoxon Rank Sum Test. The remaining data was analyzed using a Student’s t-test.
