iASPP is over-expressed in human non-small cell lung cancer and regulates the proliferation of lung cancer cells through a p53 associated pathway

Cell lines, reagents and antibodies

Human lung cancer cell lines A549, 95D and H1229 were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA) and cultured either in in F-12K medium (A549 cells) or RPMI-1640 medium (95D cells and H1229 cells) containing 10% fetal bovine serum, at 37°C with 5% v/v CO₂. MTT assay reagents were purchased from DingGuo Biotech (Beijing, China). 5-Bromo-2'-deoxyuridine (BrdU) assay reagents were purchased from Chemicon International (Temecula, CA, USA). Anti-iASPP mAb used for Western blot assay was purchased from Abcam (Boston, MA, USA). Anti-iASPP rAb using for Immunohistochemical assay was purchased from Rockland Immunochemicals, Inc., (Gilbertsville, PA, USA). Anti-GAPDH monoclonal was purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA).

Lentivirus-mediated shRNA delivery

Sequences of iASPP shRNA were inserted into the pGCL-GFP lentivirus RNAi expression system. The shRNA containing vectors were transfected together into 293T cells with pHelper1.0 and the lentiviral helper plasmid pHelper2.0 to generate the respective lentiviruses. Viral stocks were collected from the transduced 293T cells and were used to infect A549 cells, 95D cells and H1229 cells. The sequence of iASPP nonsense shRNA was: AATGTACTGCGCGTGGAGA; the sequence of iASPP shRNA was AACACATGGATCTGAAGCAGA. The mRNA and protein levels were measured 72 hrs after cells being infected.

Quantitative RT-PCR analysis of iASPP expression

Total RNA was extracted and reverse transcribed into cDNA using M-MLV-RTase (Promega, Madison, WI, USA). The resulting cDNA was used for PCR using the SYBR-Green Master PCR Mix (Applied Biosystem, Carlsbad, CA, USA) in triplicates. Primers for qRT-PCR were as follows: iASPP forward primer: GGCGGTGAAGGAGATGAAC; iASPP reverse primer: TGATGAGGAAATCCACGATAGAGA; p53 forward primer: CCTCCTCAGCATCTTATCC; p53 reverse primer: ACAAACACGCACCTCAAA; p21 forward primer: GGGACAGCAGAGGAAGACC; p21 reverse primer: GACTAAGGCAGAAGATGTAGAGC; PUMA forward primer: GACGACCTCAACGCACAG; PUMA reverse primer: CACCTAATTGGGCTCCATCTC. PCR and data collection were performed on the TP800 qPCR System (Takara, Japan). All quantitations were normalized to an endogenous β-actin control. β-actin forward primer: GGCGGCACCACCATGTACCCT; β-actin reverse primer: AGGGGCCGGACTCGTCATACT. The relative quantitation value for each target gene compared to the calibrator for that target is expressed as 2^-(Ct-Cc) (Ct and Cc are the mean threshold cycle differences after normalizing to β-actin).

Western blot

Protein samples prepared from the cells were subjected to SDS-PAGE, transferred to PVDF membranes (Millipore, Kankakee, IL, USA) and detected with appropriate primary antibodies followed by horseradish peroxidase-conjugated goat, anti-mouse or rabbit IgG. The protein signals were detected using SuperSignal West Dura Extended Duration Substrate (Pierce, Rockford, IL, USA).

MTT assay

All the cells, including those transfected, were grown in exponential phase and detached by trypsin/EDTA treatment. Viable cells (2,000 cells/ml) were plated into 96-well tissue culture plates (100 μl complete medium/well) and cultured at 37°C in 5% CO₂. At different time points, MTT reagent was added (10 μl per well) and incubated at 37°C for 4 hr. The reaction was stopped with addition of 100 μl DMSO and the optical density was determined at OD570 nm on a multi-well plate reader. Data from three independent experiments were analyzed by student t test and p < 0.05 was considered statistically significant.

BrdU assay

Cells were seeded into 96-well plates (1,500 cells/well) and cultured at 37°C in 5% CO₂. At different time points, BrdU reagent was added (20 μl/well) and incubated at 37°C for 4 hr. Cells were then fixed in a fixation solution for 30 min. After washing three times with a washing buffer, anti-BrdU antibody was added (50 μl/well) and incubated at 37°C for 1 hr. Following washing, an enzyme conjugated secondary antibody was added (50 μl/well) and incubated at 37°C for a further 30 min. Colour was then developed by incubation with 50 μl TMB substrate for 30 min in dark and the optical density was determined at OD490 nm on a multi-well plate reader. Data from three independent experiments were analyzed by student t test and p < 0.05 was considered statistically significant.

Colony formation assay

Cells were seeded into six-well plates (200 cells/well) (in three duplicate wells) and cultured at 37°C in 5% CO₂. After two weeks, the cells were fixed with paraformaldehyde for 30 min and then stained with GIEMSA for 10 min. ddH2O was used to wash the cells three times to obtain a clean background. The number of colonies and the cell number in each colony were counted and statistically analyzed.

Immunohistochemical Staining

Tissues sections (5-μm thick) were dewaxed, followed by quenching the endogenous peroxidase with 3% H₂O₂ in methanol for 30 min. Prior to staining, non-specific binding was blocked by incubation with 10% BSA in PBS at 37°C for 1 hr. Tissue sections were incubated with pre-immune IgG or specific antibodies in PBS containing 1% BSA at 4°C overnight, followed by incubation with a horseradish peroxidase-conjugated anti-mouse or rabbit antibody. Colour was then developed by incubation with an ImmunoPure Metal Enhanced Diaminobenzidine (DAB) Substrate kit (Pierce). After each incubation, tissue sections were washed three times in PBS for 10 min. Tissue sections were finally counterstained with hematoxylin. For determination of iASPP immunoreactivity, cytosolic staining of yellowish or brownish granules was graded as follows: 0 for background staining, 1 for faint staining, 2 for moderate staining and 3 for strong staining. In addition, positive staining areas in entire tissue section were graded as follows: 0 for <5%, 1 for 5-25%, 2 for 26-50%, 3 for 51-75%, and 4 for 76%-100%. When combining these two parameters, 0-2 and ≥3 were considered negative and positive staining, respectively.

Statistical analysis was carried using SPSS (version 16). Fisher's Exact test was used for analyzing the immunohistochemical data and Student t test for other quantitative data.

Over-expression of the iASSP protein in human lung cancer tissues

To determine the expression pattern of iASPP protein in human lung cancer, immunohistochemical analysis was performed on 49 pairs of tumour and normal tissues from patients pathologically verified for having lung carcinoma. Immunoreactivity for iASSP antigens was seen in 40.82% (20/49) of lung cancer tissues and 4.35% (2/46) of adjacent non-cancerous tissues (Figure 1), p < 0.001 by Fisher's Exact test. The number of samples that were assigned each score is shown in Table 1. Others previously reported that SNPs in iASPP are related to the response of chemotherapy and radiotherapy in NSCLC (non-small cell lung cancer) patients [20]. Thus, the increase in iASPP expression may play an important role in the pathogenesis of human lung cancer.

Reduction of iASPP mRNA and protein expression by shRNA in vitro

To further investigate the biological role of iASPP in lung cancer cells, we knocked down iASPP transcript in human lung cancer cell lines A549 cells, 95D cells and H1229 cells. This was carried out by employing shRNA technology. shRNA to iASPP was constructed into PGCL-GFP vector using lentivirus transfection system, as shown in Figure 2A. The lentivirus transfection system successfully down-regulated iASPP expression at both mRNA level and protein level in A549 cells, 95D cells and H1229 cells, in comparison with blank controls or nonsense shRNA controls (Figure 2B, C).

iASPP down-regulation inhibited the proliferation of A549 cells and 95D cells

Using the iASPP knockdown cells, we first tested the change of cell growth, using the MTT assay. The results showed a significant decrease of cell growth and indicated that cell proliferation was inhibited after transfection with iASPP shRNA both in A549 cells and 95D cells (Figure 2D, E). To further conform this result, we carried out an alternative proliferation assay, the BrdU assay. Consistent with the observations made with the MTT assay, both A549 cells and 95D cells showed lower BrdU positive staining after the cells were treated with iASPP shRNA than the blank controls or cells treated with nonsense shRNA for 48 hours (Figure 2F, G). Our results thus suggested that shRNA mediated down-regulation of iASPP inhibited proliferation of lung cancer cells. It is interesting to observe that BrdU assay appeared to be a more sensitive method than the MTT assay. A significant difference was seen as early as 48 hours with the BrdU assay (Figure 2D), whereas with the MTT assay (Figure 2F), the difference was seen after 4 days.

iASPP down-regulation inhibited the colony formation of A549 cells

Transfection of A549 cells with iASPP shRNA resulted in a significant decrease in cell numbers in each colony, when compared with A549 cells treated with blank control or nonsense shRNA (Figure 3A, B). The number of colonies with more than 50 cells was also decreased in iASPP shRNA transfected cells (Figure 3C, D). 95D cells were unable to form colonies and were unable to be assessed for this cellular function (data not shown).

iASPP regulated lung cancer cell proliferation, a connection with the p53 pathway

Although iASPP down-regulation inhibited the proliferation of A549 cells and 95D cells, there was no changes in the proliferation of H1229 cells when treated with iASPP shRNA, as evident from both MTT and BrdU assays (Figure 4A, and data not shown). Since iASPP has been reported as a regulator of p53, we thus suspected that the difference between A549/95D cells and H1229 cells in their response to iASPP shRNA may be due to different p53 expression. Consistent with our hypothesis, it was found that the H1229 cells expressed little iASSP mRNA, whereas A549 cells and 95D cells showed high levels of the wild-type iASPP mRNA (Figure 4B). As a downstream effector of p53 activation, p21 and PUMA [21, 22] were also found to be significantly increased in A549 cells after treatment with iASPP shRNA, when compared with blank control or nonsense shRNA (Figure 4C, D). This provides further support that iASPP regulates lung cancer cell proliferation in a manner that is associated with the p53 pathway.