Skip to main content

Up-regulation expression and prognostic significance of Syntaxin4 in kidney renal clear cell carcinoma

Abstract

Background

Syntaxin4 (STX4) gene encodes the protein STX4, a member of soluble N-ethylmaleimide-sensitive factor attachment protein receptors protein, playing a vital role in cell invadopodium formation and invasion, which is associated with the malignant progression of various human cancers. However, the expression and prognostic significance of STX4 in kidney renal clear cell carcinoma (KIRC) remain to be investigated.

Methods

In this study, we collected the mRNA expression of STX4 in 535 KIRC patients from The Cancer Genome Atlasthrough the University of California Santa Cruz Xena database platform. Then we explored the expression of STX4 in KIRC, and the relationship with clinicopathological characteristics and prognostic value. Gene Ontology and Kyoto Encyclopedia of Genes and Genomes function enrichment analyses were used to explore the potential mechanism of STX4 in KIRC. qRT-PCR analysis was performed toverify the above results with real world tissue specimens.

Results

The results indicated that STX4 was up-expressed in KIRC, and were associated with higher histological grade, advanced stage, and poorer prognosis. Moreover, elevated STX4 expression is an independent risk factor for KIRC. qRT-PCR analysis showed that STX4 was significantly elevated in 10 paired of KIRC samples compared to normal samples. Functional enrichment analysis indicated that endo/exocytosis, autophagy, mTOR signaling pathway, and NOD-like receptor signaling pathway were enriched.

Conclusions

In summary, STX4 is constantly up-expressed in KIRC tissues, associated with a poor prognosis. We suggest that it can be an effective biomarker for the prognosis of KIRC and may be a novel therapeutic target in KIRC.

Peer Review reports

Background

Kidney renal clear cell carcinoma (KIRC) is the main histological subtype of the renal cell carcinoma (RCC), accounting for 80–90% of patients [1]. KIRC was one of the ten leading cancer types for the estimated new cancer cases and deaths in the United States, and it had caused about 14,770 new deaths according to cancer statistics data in 2019 [2]. More than half of KIRC patients are a symptomless and diagnosed incidentally on imaging [3]. Although nephrectomy or targeted therapies had been implementation, approximately 30% of patients with localized tumor eventually develop metastases and the 5-year survival rate for patients with metastatic is less than 10% [4, 5]. The TNM stage is usually used as risk predictors for KIRC [6], but the outcomes for KIRC were heterogeneous in various aspects including clinicopathological, molecular, and cellular heterogeneity. Therefore, it is urgent to study the carcinogenesis and progression of KIRC and explore new useful molecular markers for prognosis.

Metastasis is a complex multicellular process that dependents on tumor cell invasion through the extracellular matrix, a supportive scaffold that acts to compartmentalize tissues [7]. Membrane trafficking of cellular cargo mediated in part by soluble N-ethylmaleimide-sensitive factor attachment protein receptors (SNAREs), a family of membrane proteins that form complexes bridging apposed membranes and allowing membrane fusion [8]. Syntaxin4 (STX4) is one of SNAREs proteins implicated in the trafficking of membrane type-1 matrix metalloproteinase (MT1-MMP) to the plasma membrane [9]. Recent research has shown that STX4 mediates invadopodium formation and tumor cell invasion [10]. However, it is unclear whether STX4 involved in the metastasis of KIRC. In this study, we explored and identified the STX4 associated with survival in patients with KIRC. We found that the SNAREs protein STX4 was positively correlated with malignant clinicopathological characteristics and was significantly related to overall survival (OS) in patients with KIRC. Most importantly, elevated STX4 expression is an independent risk factor for KIRC.

Methods

Data extraction and identification of prognostic STX4 in KIRC

The study is approved by Medical Ethics Committee of Meizhou People’s Hospital (2020-CY-06) and in accordance with the ethical standards of the institutional and/or national research committee and with the 1964 Helsinki declaration and its later amendments or comparable ethical standards. We collected the mRNA expression of STX4 and clinical data of 535 KIRC patients from The Cancer Genome Atlas (TCGA) through the University of California Santa Cruz Xena database platform (https://xena.ucsc.edu/). Among them, 531 KIRC patients had information regarding survival. We matched the patients’ clinical information and STX4 mRNA expression data. The different expression of STX4 was compared between 535 KIRC samples and 72 normal kidney samples. The correlation between the expression level of STX4 and clinicopathological characteristics in KIRC was also assessed. Kaplan–Meier (KM) survival curves was used for prognosis analysis using the R packages “survival” and “survminer”, Log-rank test P value< 0.05 was chosen to be significantly different. Finally, we validated the results using the pan-cancer data from TCGA (32 other types of cancer) and qRT-PCR results of 10 paired of KIRC and normal real-world samples as internal and external validations, respectively.

Quantitative reverse transcription polymerase chain reaction (qRT-PCR)

To further validate the RNA-sequencing data obtained from TCGA, qRT-PCR analysis was performed to validate the expression of STX4 in 10 paired of KIRC and normal samples. We collected KIRC samples and paired adjacent normal samples from 10 patients who underwent nephrectomies or partial nephrectomies at Meizhou People’s Hospital between 2019 and 2020. Informed consent was obtained from all patients. We extracted total RNA using the TRIzol™ reagent (Waltham, Massachusetts, USA). First-strand complementary DNA was synthesized equal amounts of total RNA (4 μg) using the PrimeScript RT reagent kit (Takara Bio, Inc., Dalian, China) according to the manufacturer’s instructions. Analyzed by The SYBR Green PCR kit (Takara Bio, Inc., Dalian, China) incorporation in PCR reactions involving specific primers and performed in the ABI 7500 fluorescent quantitative PCR system (Applied Biosystems Inc., Foster City, CA, USA). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as the internal control. Thespecific primer sequences were as follows: STX4 (forward: CTGTCCCAGCAATTCGTGGAG; reverse: CCCAGCATTGGTGATCTTCAG), and GAPDH (forward: ATGACATCAAGAAGGTGGTG; reverse: CATACCAGGAAATGA GCTTG). The expression level was also calculated using the 2–ΔΔCt method.

Functional and pathway enrichment analyses

To identify biological functions in STX4 gene set, we carried out a Gene Ontology (GO) classification, which included the following categories: biological process, cellular component, and molecular functions. We firstly explored the co-expressed genes with the STX4 (correlation coefficient r > 0.4, P <  0.001). Then we used the entire co-expressed genes matrix after pre-processing as a background, and performed GO functional enrichment analysis at online tools (http://kobas.cbi.pku.edu.cn/) [11]. We explored the Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis with the same method.

Statistics

All data processing and statistical analysis were performed using R (version 3.6.1; The R Foundation for Statistical Computing, Vienna, Austria), Strawberry Perl (version 5.30.1.1; http://strawberryperl.com/), and Statistical Pack/ age for Social Sciences (version 25.0; IBM, Armonk, New York, USA). Analysis of variance or t-test was used to compare the gene expression level among different subgroups. The differences were considered significant when P<0.05.

Results

STX4 expression was significantly up-regulated in KIRC

After matching the patients’ clinical information and STX4 gene expression data, 535 patients with KIRC were enrolled in the study. The 535 patients’ clinicopathological features are shown in Table 1. After analyzing the expression levels of STX4 in 535 KIRC samples and 72 normal kidney samples, we found that the expression of STX4 in KIRC tissues was obviously higher compared with normal tissues (P<0.05) (Fig. 1A). To validate STX4 mRNA expression in KIRC tissues, we performed qRT-PCR in 10 paired tumor and normal samples. Compared with normal tissues, the expression of STX4 in KIRC tissues was significantly elevated by qRT-PCR result (P<0.05) (Fig. 1B,C).

Table 1 Correlations between the expression of STX4 and clinicopathologic characteristics in KIRC
Fig. 1
figure1

Expression of STX4 mRNA in human KIRC. (A) STX4 transcription level was significantly higher in 535 KIRC tissue samples than in 72 normal tissue samples. (B) STX4 was up-regulated in 8 of 10 KIRC tissue samples. (C) Compared with normal tissue samples, STX4 was significantly up-regulated in tumor samples of 10 paired samples

Up-expression of STX4 predicts poor prognosis of KIRC

Then we investigated the prognostic value of STX4 in KIRC. According to the median expression level of STX4, 531 patients with KIRC with survival information were divided into the high-STX4 and low-STX4 expression groups. As shown by the Kaplan–Meier (KM) survival analysis curve, there was a close relationship between the expression of STX4 and the survival of KIRC patients that the high expression of STX4 caused poor OS (HR = 2.3, P <  0.001, Fig. 2A). We next investigated the relationship between STX4 expression and the clinicopathological characteristics of KIRC. Analysis results showed that the STX4 expression level was significantly related to several clinicopathological features of KIRC, including cancer status (P = 0.003), histological grade (P <  0.001), tumor size (T stage, P <  0.001), distant metastasis (M stage, P <  0.001), and American Joint Committee on Cancer (AJCC) stage (P <  0.001) (Table 1). As shown in Fig. 2B, STX4 expression in KIRC tissues was significantly correlated with pathological grade (P <  0.001). Figure 2C showed the relationship between STX4 expression and different clinical stages, and the results suggested that STX4 expression was positively correlated with advanced clinical stage (P <  0.001).

Fig. 2
figure2

Prognosis and gene alteration of STX4 in KIRC. (A) STX4 up-regulation was significantly correlated with poorer overall survival in KIRC. (B) STX4 expression significantly elevated with increasing histological grade. (C) STX4 expression significantly elevated with advanced AJCC stages. KIRC, kidney renal clear cell carcinoma; AJCC, American Joint Committee on Cancer

To further validate the results, we explored the expression of STX4 in pan-cancer data (32 other cancer types) from TCGA as an internal validation. The “high” and “low” subgroups were always defined based on the mean expression value of STX4 in pan-cancer. According to the result of KM survival analysis, it is interesting that STX4 also played a prognostic role in cervical squamous cell carcinoma and endocervical adenocarcinoma, skin cutaneous melanoma, and uveal melanoma (Table 2). These results suggest that STX4 functions as a tumor promoter in KIRC.

Table 2 Kaplan-Meier survival analysis for STX4 in pan-cancer (33 types of cancer from TCGA)

Independent prognostic analysis of STX4 in KIRC

On the basis of KM survival analysis curve showing that KIRC patients with up-expression of STX4 had obviously poor OS, univariate and multivariate Cox regression analyses were used to further explored whether STX4 had an independent prognostic value in KIRC. The results showed that there was a significantly prognostic difference between the high-STX4 and low-STX4 expression groups in both univariate (HR, 1.743; 95%CI, 1.279–2.374; P < 0.001) and multivariate (HR, 1.625; 95%CI, 1.187–2.223; P = 0.002) Cox regression analyses, which suggested that STX4 was an independent prognostic factor in KIRC (Fig. 3A, B).

Fig. 3
figure3

Forest plot of Cox regression analysis in KIRC. (A) Forest plot of univariate Cox regression analysis. (B) Forest plot of multivariate Cox regression analysis

Functional and pathway enrichment analyses

GO functional enrichment analysis and KEGG analysis for STX4 were performed to investigate the molecular function and biological process of STX4. GO functional enrichment analysis for proteins interacting with STX4 demonstrated that the molecular functions cover protein binding processes, protein transport processes, and endosomal transport processes, autophagosome, and ubiquitin binding (Table 3). KEGG analysis revealed that the endocytosis, lysosome, and proteasome were enriched (Table 4). Meanwhile, mTOR signaling pathway, NOD-like receptor signaling pathway, and SNARE interactions in vesicular transport were also enriched (Table 4).

Table 3 GO function analysis for proteins interacting with STX4
Table 4 KEGG function analysis for proteins interacting with STX4

Discussion

KIRC was one of the highest incidence subtypes of the RCC with poor prognosis. Due to limited predictors assessing the risk because of tumor heterogeneity, a part of KIRC patients with poor prognosis might be miss aggressive treatment due to a delay in diagnosis, which would decrease the survival rate of patients with KIRC to some extent. Hence, it is crucial to identify new specific prognosis predictors for KIRC.

STX4 is one of the SNAREs proteins and is involved in cell invadopodium formation and tumor cell invasion [9, 10]. Research has shown that STX4 also plays an important role in several cancers. A research had identified the exocytosis mediator proteins STX4 in the peripheral blood neutrophils of patients with chronic myeloid leukemia early in 2004 [12]. Breast cancer showed the strongest correlation with the expression of STX4, the latter was associated with reduced patient survival in high expression [13]. Extracellular STX4 triggers the differentiation program in teratocarcinoma F9 cells that impacts cell adhesion properties [14]. It still had not study reveal the effect of STX4 in KIRC. Here, we screened out available datasets associated with KIRC from public databases to confirm the function of STX4 on the oncoming, progression, and prognosis of KIRC. In this study, STX4 up-regulation was significantly associated with unfavorable clinicopathological features in KIRC, such as higher histological grade, larger tumor size, distant metastasis, and advanced AJCC stage. KM survival analysis curve showed that STX4 expression had maintained a high level with a poor OS. Furthermore, univariate and multivariate Cox regression analyses confirmed that STX4 played an independent prognostic role in KIRC. The qRT-PCR results from 10 paired of KIRC and normal real-world samples further confirmed the up-regulation of STX4 in KIRC. This suggested that STX4 could be identified as a potential prognostic biomarker in KIRC.

We used data of 32 other types of cancer from TCGA to validate the aforementioned results. As the pan-cancer analysis result shown that survival differences of STX4 existed in several types of cancer. All results were consistent and suggested that STX4 may serve as a tumor promoter in KIRC.

Further research into how STX4 influences patients’ survival via GO functional enrichment analysis and KEGG analysis. These analyses demonstrated that the molecular functions of STX4 cover protein binding processes, protein transport processes, endosomal transport processes, and endocytosis, which suggest that STX4 influences the endo/exocytosis of the tumor. The fusion of secretory vesicles and subsequent protein exocytosis are the important mechanism of cancer cells metastasis [7]. Alterations of endo/exocytic proteins have long been associated with malignant transformation, and genes encoding membrane trafficking proteins have been identified as bona fide drivers of tumorigenesis [15]. Results had demonstrated that STX4 defines a domain for activity-dependent exocytosis in dendritic spines [16, 17] STX4 mediated trafficking of MT1-MMP during invadopodium formation and tumor cell invasion [10, 18]. Autophagosome, lysosome, mTOR signaling pathway, and NOD-like receptor signaling pathway were also enriched by GO and KEGG analyses. Autophagy is a lysosomal-dependent pathway for intracellular degradation, leading to the basal turnover of cell components and providing energy and macromolecular precursors. Autophagy has opposing, context-dependent roles in cancer, and interventions to both stimulate and inhibit autophagy have been proposed as cancer therapies [19]. In addition, mTOR signaling pathway and NOD-like receptor signaling pathway play a crucial role in regulating autophagy [20,21,22]. STX2 to block STX3- and STX4-mediated fusion of zymogen granules with the plasma membrane and exocytosis and prevent binding of ATG16L1 to clathrin, which contributes to induction of autophagy [23]. Thus, we speculated that STX4 may promote the tumor progression and influence the prognosis of KIRC by regulating endo/exocytosis, and autophagy.

This study has several limitations, although it is the first to discover the potential prognostic value of STX4 in KIRC. First, although differential STX4 expression was detected between tumor and normal real-world samples, the prognostic implication of this finding has not been demonstrated. Second, only transcriptomics expression of STX4 with clinical data was analyzed to predict OS in this study. Third, the underlying mechanisms of STX4 in KIRC remain unclear, only function enrichment analyses were performed. Therefore, additional data and samples are necessary to confirm the results of this study. Future research is required to explore the detailed molecular mechanism of STX4 in KIRC.

In conclusion, this study demonstrated that STX4 is a key survival-associated marker in KIRC. With a potential role in endo/exocytosis, STX4 may be a novel therapeutic target in patients with KIRC.

Availability of data and materials

The datasets generated and/or analysed during the current study are available in the [The Cancer Genome Atlas (TCGA) through the University of California Santa Cruz Xena database platform] repository, (https://xena.ucsc.edu/).

Abbreviations

KIRC:

Kidney renal clear cell carcinoma

OS:

Overall survival

TCGA:

The Cancer Genome Atlas

PresSTIGE:

Predicting Specific Tissue Interactions of Genes and Enhancers

qRT-PCR:

Quantitative reverse transcription polymerase chain reaction

GAPDH:

glyceraldehyde 3-phosphate dehydrogenase

GO:

Gene Ontology

KEGG:

Kyoto Encyclopedia of Genes and Genomes

AJCC:

American Joint Committee on Cancer

References

  1. 1.

    Ljungberg B, Bensalah K, Canfield S, Dabestani S, Hofmann F, Hora M, et al. EAU guidelines on renal cell carcinoma: 2014 update. Eur Urol. 2015;67(5):913–24. https://doi.org/10.1016/j.eururo.2015.01.005.

    Article  PubMed  Google Scholar 

  2. 2.

    Siegel RL, Miller KD, Jemal A. Cancer statistics, 2019. CA Cancer J Clin. 2019;69(1):7–34. https://doi.org/10.3322/caac.21551.

    Article  PubMed  Google Scholar 

  3. 3.

    Gray RE, Harris GT. Renal cell carcinoma: diagnosis and management. Am Fam Physician. 2019;99(3):179–84.

    PubMed  Google Scholar 

  4. 4.

    Hsieh JJ, Purdue MP, Signoretti S, Swanton C, Albiges L, Schmidinger M, et al. Renal cell carcinoma. Nat Rev Dis Primers. 2017;3(1):17009. https://doi.org/10.1038/nrdp.2017.9.

    Article  PubMed  PubMed Central  Google Scholar 

  5. 5.

    Mitsui Y, Shiina H, Kato T, Maekawa S, Hashimoto Y, Shiina M, et al. Versican promotes tumor progression, metastasis and predicts poor prognosis in renal carcinoma. Mol Cancer Res. 2017;15(7):884–95. https://doi.org/10.1158/1541-7786.MCR-16-0444.

    CAS  Article  PubMed  PubMed Central  Google Scholar 

  6. 6.

    Motzer RJ, Jonasch E, Agarwal N, Beard C, Bhayani S, Bolger GB, et al. National comprehensive cancer network. Kidney cancer, version 3. 2015. J Natl Compr Cancer Netw. 2015;13(2):151–9. https://doi.org/10.6004/jnccn.2015.0022.

    Article  Google Scholar 

  7. 7.

    Stephens DC, Harris DA. Organizing 'Elements': facilitating exocytosis and promoting metastasis. Trends Cancer. 2020;6(4):273–6. https://doi.org/10.1016/j.trecan.2020.01.020.

    CAS  Article  PubMed  Google Scholar 

  8. 8.

    Chen YA, Scheller RH. SNARE-mediated membrane fusion. Nat Rev Mol Cell Biol. 2001;2(2):98–106. https://doi.org/10.1038/35052017.

    CAS  Article  PubMed  Google Scholar 

  9. 9.

    Miyata T, Ohnishi H, Suzuki J, Yoshikumi Y, Ohno H, Mashima H, et al. Involvement of syntaxin 4 in the transport of membrane-type 1 matrix metalloproteinase to the plasma membrane in human gastric epithelial cells. Biochem Biophys Res Commun. 2004;323(1):118–24. https://doi.org/10.1016/j.bbrc.2004.08.064.

    CAS  Article  PubMed  Google Scholar 

  10. 10.

    Brasher MI, Martynowicz DM, Grafinger OR, Hucik A, Shanks-Skinner E, Uniacke J, et al. Interaction of Munc18c and syntaxin4 facilitates invadopodium formation and extracellular matrix invasion of tumor cells. J Biol Chem. 2017;292(39):16199–210. https://doi.org/10.1074/jbc.M117.807438.

    CAS  Article  PubMed  PubMed Central  Google Scholar 

  11. 11.

    Xie C, Mao X, Huang J, Ding Y, Wu J, Dong S, et al. KOBAS 2.0: a web server for annotation and identification of enriched pathways and diseases. Nucleic Acids Res. 2011;39:W316–22.

    CAS  Article  Google Scholar 

  12. 12.

    Nuyanzina VA, Nabokina SM. Identification of exocytosis mediator proteins in peripheral blood neutrophils of patients with chronic myeloid leukemia. Bull Exp Biol Med. 2004;137(4):361–3. https://doi.org/10.1023/B:BEBM.0000035130.80245.13.

    CAS  Article  PubMed  Google Scholar 

  13. 13.

    Althubiti M, Lezina L, Carrera S, Jukes-Jones R, Giblett SM, Antonov A, et al. Characterization of novel markers of senescence and their prognostic potential in cancer. Cell Death Dis. 2014;5(11):e1528. https://doi.org/10.1038/cddis.2014.489.

    CAS  Article  PubMed  PubMed Central  Google Scholar 

  14. 14.

    Hagiwara N, Kadono N, Miyazaki T, Maekubo K, Hirai Y. Extracellular syntaxin4 triggers the differentiation program in teratocarcinoma F9 cells that impacts cell adhesion properties. Cell Tissue Res. 2013;354(2):581–91. https://doi.org/10.1007/s00441-013-1680-0.

    CAS  Article  PubMed  Google Scholar 

  15. 15.

    Lanzetti L, Di Fiore PP. Behind the scenes: Endo/exocytosis in the Acquisition of Metastatic Traits. Cancer Res. 2017;77(8):1813–7. https://doi.org/10.1158/0008-5472.CAN-16-3403.

    CAS  Article  PubMed  Google Scholar 

  16. 16.

    Kennedy MJ, Davison IG, Robinson CG, Ehlers MD. Syntaxin-4 defines a domain for activity-dependent exocytosis in dendritic spines. Cell. 2010;141(3):524–35. https://doi.org/10.1016/j.cell.2010.02.042.

    CAS  Article  PubMed  PubMed Central  Google Scholar 

  17. 17.

    Mohanasundaram P, Shanmugam MM. Role of syntaxin 4 in activity-dependent exocytosis and synaptic plasticity in hippocampal neurons. Sci Signal. 2010;3:jc7.

    Article  Google Scholar 

  18. 18.

    Williams KC, McNeilly RE, Coppolino MG. SNAP23, Syntaxin4, and vesicle-associated membrane protein 7 (VAMP7) mediate trafficking of membrane type 1-matrix metalloproteinase (MT1-MMP) during invadopodium formation and tumor cell invasion. Mol Biol Cell. 2014;25(13):2061–70. https://doi.org/10.1091/mbc.e13-10-0582.

    Article  PubMed  PubMed Central  Google Scholar 

  19. 19.

    Levy JMM, Towers CG, Thorburn A. Targeting autophagy in cancer. Nat Rev Cancer. 2017;17(9):528–42. https://doi.org/10.1038/nrc.2017.53.

    CAS  Article  PubMed  Google Scholar 

  20. 20.

    Kim YC, Guan KL. mTOR: a pharmacologic target for autophagy regulation. J Clin Invest. 2015;125:25–32.

    Article  Google Scholar 

  21. 21.

    Kim YK, Shin JS, Nahm MH. NOD-like receptors in infection, immunity, and diseases. Yonsei Med J. 2016;57(1):5–14. https://doi.org/10.3349/ymj.2016.57.1.5.

    CAS  Article  PubMed  Google Scholar 

  22. 22.

    Travassos LH, Carneiro LA, Ramjeet M, Hussey S, Kim YG, Magalhães JG, et al. Nod1 and Nod2 direct autophagy by recruiting ATG16L1 to the plasma membrane at the site of bacterial entry. Nat Immun. 2010;11(1):55–62. https://doi.org/10.1038/ni.1823.

    CAS  Article  Google Scholar 

  23. 23.

    Dolai S, Liang T, Orabi AI, Holmyard D, Xie L, Greitzer-Antes D, et al. Pancreatitis-induced depletion of Syntaxin 2 promotes autophagy and increases Basolateral exocytosis. Gastroenterology. 2018;154:1805–1821.e5.

    CAS  Article  Google Scholar 

Download references

Acknowledgements

Not applicable.

Funding

This work was supported by the Peiyu Project of Meizhou People’s Hospital (Grant/Award No. PY-C2019011) and (Grant/Award No. PY-C2020004).

Author information

Affiliations

Authors

Contributions

Conceived and designed the experiments: ZQ H, ZX Z. Performed the experiments: LS H, ZQ L. Analyzed the data, generated the tables, and figures: HM J. Contributed reagents/materials/analysis tools and expertise: LS H. Wrote the manuscript: LS H. Revised the manuscript: LS H, HM J, ZQ H. All authors approved the submitted version.

Corresponding authors

Correspondence to Lishan He, Zhixiong Zhong or Zhanqin Huang.

Ethics declarations

Ethics approval and consent to participate

The study is approved by Medical Ethics Committee of Meizhou People’s Hospital (2020-CY-06) and in accordance with the ethical standards of the institutional and/or national research committee and with the 1964 Helsinki declaration and its later amendments or comparable ethical standards. Informed consent was obtained from all patients.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and Permissions

About this article

Verify currency and authenticity via CrossMark

Cite this article

He, L., Jiang, H., Lai, Z. et al. Up-regulation expression and prognostic significance of Syntaxin4 in kidney renal clear cell carcinoma. BMC Cancer 21, 992 (2021). https://doi.org/10.1186/s12885-021-08736-1

Download citation

Keywords

  • Syntaxin4
  • Kidney renal clear cell carcinoma
  • Endo/exocytosis
  • Cell invasion
  • Prognostic