Skip to main content

Association of genetic polymorphisms CYP2A6*2 rs1801272 and CYP2A6*9 rs28399433 with tobacco-induced lung Cancer: case-control study in an Egyptian population



Several studies have reported the role of CYP2A6 genetic polymorphisms in smoking and lung cancer risk with some contradictory results in different populations. The purpose of the current study is to assess the contribution of the CYP2A6*2 rs1801272 and CYP2A6*9 rs28399433 gene polymorphisms and tobacco smoking in the risk of lung cancer in an Egyptian population.


A case-control study was conducted on 150 lung cancer cases and 150 controls. All subjects were subjected to blood sampling for Extraction of genomic DNA and Genotyping of the CYP2A6 gene SNPs (CYP2A6*2 (1799 T > A) rs1801272 and CYP2A6*9 (− 48 T > G) rs28399433 by Real time PCR.


AC and CC genotypes were detected in CYP2A6*9; and AT genotype in CYP2A6*2. The frequency of CYP2A6*2 and CYP2A6*9 were 0.7% and 3.7% respectively in the studied Egyptian population. All cancer cases with slow metabolizer variants were NSCLC. Non-smokers represented 71.4% of the CYP2A6 variants. There was no statistical significant association between risk of lung cancer, smoking habits, heaviness of smoking and the different polymorphisms of CYP2A6 genotypes.


The frequency of slow metabolizers CYP2A6*2 and CYP2A6*9 are poor in the studied Egyptian population. Our findings did not suggest any association between CYP2A6 genotypes and risk of lung cancer.

Peer Review reports


Lung Cancer is the most common cancer worldwide in term of new cases (1.8 million, 12.9%) & in term of death (1.6 million death, 19.4%) [1]. Cytochrome P450 2A6 (CYP2A6), one of the forms of CYP expressed in the human respiratory tract, is the main enzyme involved in the metabolic activation of tobacco-specific nitrosamines to their carcinogenic forms [2]. CYP2A6 inactivates nicotine, the principle component in cigarette smoke, to cotinine [3]. Thus it is reasonable to hypothesize that CYP2A6 activity may be related to the susceptibility of developing lung cancer among smokers.

The existence of a CYP2A6 genetic polymorphism was suggested by evidence that there was extensive inter individual difference in the capacity of coumarin 7-hydroxylation [4, 5]. Detecting the alleles of CYP2A6 can help us to describe different smoking behaviors and smoking-related diseases among individuals [6]. Numerous characterized alleles and some haplotypes that are uncharacterized have been identified & most of these are derived from single nucleotide polymorphisms (SNPS) in regulatory & coding regions [7]. The wild-type allele that is considered as a reference is CYP2A6*1A [8]. Currently CYP2A6*6, CYP2A6*7, CYP2A6*9, CYP2A6*10, CYP2A6*11, &, CYP2A6*13 are known to lead to reduced enzymatic activities while 5 variants (CYP2A6*2, CYP2A6*4, CYP2A6*5, CYP2A6*12, & CYP2A6*20) produce no functional enzyme [2, 9,10,11,12].

The CYP2A6*2 variant, appears to be one of the causal polymorphisms associated with decreased or virtually absent nicotine metabolism in Caucasians [13, 14]. In East and Southeast Asian populations such as Chinese, Korean, Japanese, Malaysian and Thai, CYP2A6*2 is non-existent [15,16,17,18,19]. CYP2A6*4C is the most widely studied allele in all populations. East Asian populations such as Japanese, Chinese, Korean & malysian showed the highest frequency among populations (4.9–25.6%) [2, 12, 17, 20]. Caucasians had a frequency lower than 3% while Middle East populations such as Turkish and Iranian showed a lower frequency [21].CYP2A6*7 has a higher frequency in East and Southeast Asian populations [6, 17, 19, 22]. On the other hand, in Indian, African, Canadian native this allele isn’t found. It has also been reported in a lower frequency in Caucasian (≤0.3%) [21].

The CYP2A6*9 is present in all ethnic groups but its frequency varies from 6 to 8% in Europeans & Africans to 21% in Asian populations [23, 24]. Middle East population as Turkish [10] & Iranian [25] also showed a high frequency. CYP2A6*9 was reported as one of the most common variants of CYP2A6 in Caucasians that modifies the levels of enzyme expression [10].

Considerable studies have reported the role of CYP2A6 genetic polymorphisms in lung cancer risk with some contradictory results in different populations from ethnic variation [2, 26,27,28,29,30]. It seemed probable that genetic polymorphism in CYP2A6 causing a lack of or reduced activity might result in lowering tobacco-induced lung cancer risk, by decreased smoking. This is due to decreased activation of carcinogens such as nitrosamines present in tobacco smoke, or by lower nicotine catabolism or by both [2, 6].

Thus knowing that CYP2A6 activity affects genetic suscebility to tobacco- induced lung cancer, individuals possessing the CYP2A6*2 and/or CYP2A6*9, but not the CYP2A6*1A allele would be expected to be at lower risk for lung cancer.

We conducted a case-control study to assess the contribution of the CYP2A6*2 rs1801272 and CYP2A6*9 rs28399433 gene polymorphisms and tobacco smoking in the risk of lung cancer in an Egyptian population.



This study was a collaboration between National Research Center and National Cancer Institute (NCI) Cairo University. A case-control study was conducted that included 150 unrelated adult patients with primary lung cancer and 150 unrelated controls. The case series consisted of patients presented to NCI details of which have been described elsewhere [31]. Almost half of the patients seen at NCI-Cairo came from the Cairo metropolitan area, whereas the rest of the patients were from other regions in South and North Egypt. Patients from the non-Cairo regions sought management at NCI-Cairo because it has the largest lung cancer services in Egypt for surgical and medical oncology & radiotherapy. All subjects included in the study were interviewed to fulfill questionnaire covering demographic information, data on smoking, occupational history and family history of malignancy. All subjects were aware of the study protocol and gave written informed consent. The study was approved by the ethical committee of the National Research Center.

DNA extraction

A peripheral blood sample is obtained from each subject through venipuncture. Blood was collected in tubes with EDETA. Extraction of genomic DNA was performed using a QIAamp DNA extraction kit according to the manufacturer’s protocol.

Selecting SNPs

We searched relevant publications from 1990 to 2013 in the National Center for Biotechnology Information (NCBI) data base using the following keywords: “CYP2A6”, “cigarette smoking”, “lung cancer” and “genetics”. Based on publication in Caucasian, African and Asian populations, we expect that: CYP2A6*2 and CYP2A6*9 would be interesting because the kinetics of nicotine metabolism are altered in individuals carrying any or both of these alleles.

Genotyping of CYP2A6 gene

CYP2A6*2 and CYP2A6*9 polymorphisms were genotyped using TaqMan® SNP Genotyping Assays. Primers and probes were designed by Applied Biosystems (Foster City, CA, USA) and analyses were performed on ABI 7500 Real Time PCR system (Applied Biosystems) according to the manufacturer’s protocol.

For CYP2A6*2 (1799 T > A) [rs1801272; assay ID: C_27861808_60], the VIC/FAM sequence was as follows: CCCCTGCTCACCGCCAGTGCCCCGG[T/A]GGGCGTCGATGAGGAAGCCCGCCTC.

For CYP2A6*9 (− 48 T > G) [rs28399433; assay ID: C_30634332_10], the VIC/FAM sequence was as follows: GTGACGGCTGGGGTGGTTTGCCTTT[A/C]TACTGCCTGAAAAAGAGGGATGGAC.

For genotyping quality control, negative controls were included in all SNPs and 10% of samples were randomly selected and analyzed in duplicates and the concordance rate was 100%.

Statistical analysis

Data were analyzed using SPSS version 18.0 (Chicago, IL, USA). Data were expressed as number and percentages of total for categorical variables. The Chi-square test (χ2) was used to compare the distribution of CYP2A6 genotypes between the groups. Likelihood ratio was used when the expected count was less than 5 in more than 20% of the cells. The associations between genotype and risk of lung cancer were estimated by odds ratio (OR) and 95% confidence interval (95% CI) using logistic regression models. The ORs were adjusted for age, smoking status, and pack-years. P-value < 0.05 was considered significant.


Table 1 presents the baseline characteristics of 150 lung cancer cases and 150 controls. There were statistically significant differences between age & gender. The mean age of patients is (56.7 ± 9.79 years) and that of controls is (43.3 ± 11.1 years) (p <  0.001), denoting that older age is associated with higher risk of lung cancer. A statistically significant gender difference was found between the 2 groups; 48.7% males and 51.3% females in controls and 76% males and 24% females in cancer cases, (X2 = 25.82, P <  0.0001) with increased males risk to develop lung cancers than females.

Table 1 Characteristics of control and lung cancer cases and association between cigarette smoking and risk of lung cancer

Smoking was significantly higher among cancer cases (62% smokers) compared to control (20% smokers), P <  0.0001, and (OR = 2.78, CI: 2.0–3.86) denoting a higher risk to develop lung cancer in smokers by 2.78 times the non-smokers, independent of the heaviness of smoking.

Two genotypes were detected in CYP2A6*9; heterozygote AC and homozygote CC. AC genotype was found in 4 cases in control group; 3 males and 1 female, all cases were non-smokers and 6 cases in lung cancer group; 4 males and 2 females from which 2 males were smokers > 20 pack-year. All cases were diagnosed as NSCLC (2 adenocarcinoma, 1 squamous and 3 others). CC genotype was found in 1 control case, a male, smoking > 20 pack-year (Fig. 1). One heterozygous genotype was detected in CYP2A6*2; AT. It was found in one case of lung cancer; a non-smoker male diagnosed as adenocarcinoma (Fig. 2). The 2 polymorphisms CYP2A6*9 AC and CYP2A6*2 AT were detected in a non-smoker female control case.

Fig. 1

Allelic discrimination plot of CYP2A6*9 rs28399433 genotypes

Fig. 2

Allelic discrimination plot of CYP2A6*2 rs1801272 genotypes

There was no statistical difference between the Wild type CYP2A6*1AA and CYP2A6*9, CYP2A6*2 polymorphisms regarding age, sex, smoking status, pack-year (Table 2). There was no statistical significant association between risk of lung cancer, smoking habits, heaviness of smoking and the different polymorphisms of CYP2A6 genotypes (Table 3).

Table 2 Frequency of CYP2A6 genotypes in the studied Egyptian population
Table 3 CYP2A6 genotypes, cigarette smoking and risk of lung cancer in the studied Egyptian population

There was no statistical significant difference in the CYP2A6 genotypes in different stages of lung cancer (Table 4).

Table 4 Effects of CYP2A6 genotypes on Stages of lung cancer in 150 lung cancer cases


CYP2A6 has been proposed as a novel target for smoking cessation because of its major contribution to nicotine metabolism. To the best of our knowledge this is the first study to address the relationship between CYP2A6 status, smoking & lung cancer in an Egyptian population. Our data are valuable because cases that presented to NCI were from different governorates of Egypt. The CYP2A6*1A allele is considered the wild type, corresponding to normal enzymatic activity [16]. Based on reports in the literature, we expect that CYP2A6*2 & CYP2A6*9 would be intresting because they code for reduced activity. Many human nicotine pharmacokinetic & CYP2A6 studies have demonstrated the contribution of multiple decrease-, increase-, and loss-of-function polymorphisms in CYP2A6 to the variability in nicotine metabolism [23]. In our study the control group was sampled at random thus their age distribution was much younger than that of lung cancer cases. This explains the statistical significant difference in age between cases and control. Age isn’t a confounder in our study and isn’t intended to be examined in the analysis of CYP2A6 polymorphism. The tested polymorphisms are not affected by age and our aim was to to assess the contribution of the CYP2A6*2 and CYP2A6*9 gene polymorphisms and tobacco smoking in the risk of lung cancer.

Frequency and ethnic variation

Our results showed that the frequency of CYP2A6*2 and CYP2A6*9 were 0.7% and 3.7% respectively. There was no statististical significant difference in the frequency of the tested variants between control and lung cancer goups. Further statistical studies were difficult due to low frequency of variants. Neverthelss, these poor frequencies were reported in other studies. In African populations (Afro American & Ethiopian), the CYP2A6*2 frequency is less than 1% [16, 17, 19] while it was found to be one of the major variant alleles in Caucasians; with frequency 1–3% [17, 19]. The frequency of CYP2A6*2, and *9 detected in a Brazilian population was 1.7, and 5.7% respectively [32] while in Turkish population the CYP2A6* 2 is not existing [33]. Recent researches that had analysed different frequencies of CYP2A6 genetic variants in different ethnic groups; found that the frequency of CYP2A6*2, and *9 in Caucasian almost double our findings in the Egyptian population [23]. The frequencies of CYP2A6 *2 allele in different ethenic population were 1.1%, 0.0%, 2.2%, 0.0%, 0.0% and those of CYP2A6*9 were 7.1%, 15.5%, 7.1%, 15.6%, 20.3% in African American, Canadian, Caucasian, Chinese and Japanese respectively [9, 10, 12, 18, 19, 34,35,36].


Many studies have concluded that CYP2A6 slow inactivator, or absent enzyme activity genotypes are associated with lower risk for smoking, altered smoking intensity, fewer cigarettes smoked, and increased quitting [2, 13, 19, 20, 37, 38]. Nevertheless, other studies are in disagreement with these conclusions [26, 39, 40].

Little is known about the genetic factors contributing to smoking in Egyptians. In the present study, although no statistical difference were found between CYP2A6 variants and smoking status, most cases with CYP2A6 polymorphisms were non-smoker, 10 cases from 13; 100% and 81.8% non-smokers in CYP2A6*2 and CYP2A6*9 respectively compared to 58% in CYP2A6*1 indicating a role of CYP2A6 gene variants in affecting smoking status, with slow metabolizers smoking less than fast metabolizers. Verde & colleagues [41], found that CYP2A6*2 polymorphism was strongly linked to smoking status. Moreover, it was found that the amounts of cigarette consumed daily by individuals, who harbored CYP2A6*9, were significantly less than that consumed by those who carried CYP2A6*1 (P = 0.01) [6]. Slow metabolizers (as determined by CYP2A6*2, *4, *9 and *12 alleles), are very unlikely to be smokers, take smaller puff volumes and smoke fewer cigarettes per day. They also have lower levels of dependence, benefit more from nicotine patch replacement therapy and are more capable to quit compared to normal metabolizers [2, 16, 19, 38, 42,43,44,45,46,47,48].

Contrastingly two different meta-analyses failed to confirm any evidence of the association between the CYP2A6 diminished-activity polymorphisms and cigarette consumption. The investigators of both concluded that there is no association between the reduced-activity CYP2A6 alleles and the number of cigarettes smoked [49, 50].

Malaiyandi & colleagues [16] have postulated that the continued effect of slow metabolism on reducing the number of cigarette smoked, allthrough the smoking history of slow inactivators, may influence withdrawal mechanisms and consequently aids quitting among these individuals. The noticeable temporal effect of CYP2A6 on smoking behavior and nicotine dependence necessitates further research. The poor frequencies of the variant alleles of slow inactivators extend our understanding of the impact of CYP2A6 genotype on smoking risk and behavior in Egyptian, and have important implications for smoking aetiology. The number of smokers in Egypt is 13 million out of a population of 90 million according to statistics by the state-run Central Agency for Public Mobilization and Statistics. There is minimal change in the number of smokers inspite of 40% tax increments since 2010 or photos of damaged lungs placed on every pack of cigarettes as a warning from the hazardous health consequences of smoking [51] (Mansour, 2013). According to the study by Loffredo & colleagues [52], the national prevalence of former cigarette smoking among males was 18.1%, and 27.5% reported current smoking.

Lung cancer

Sqamous cell carcinoma and Small cell lung cancer (SCLC) are major types of lung cancer caused by smoking, while adenocarcinoma isn’t regarded as a common histological type in smokers [53, 54]. In the present study, all lung cancer cases (6), with CYP2A6*2 and *9 polymorphisms were diagnosed as NSCLC, 3 of them were adenocarcinoma. Statistical interpretations could not be done due to the low frequency of variants in the study. A former study [29], did not find a significant association between this CYP2A6 polymorphism and risk of adenocarcinoma or other histological types of lung cancer.

Studies of CYP2A6 inhibition demonstrated a role for the enzyme in the occurrence of lung cancer and hence have directed the interest in CYP2A6 as a target for cancer prevention [28, 55]. Investigating the role of CYP2A6 genotype in effective programs implemented for lung cancer screening may improve cancer risk prediction and assist selecting individuals who could benefit from preventative measures whether behavioural or pharmacological [56]. Ariyoshi & colleagues [2], demonstrated that individuals homozygous for the CYP2A6*1A allele (*1A/*1A) have the highest risk for tobacco-related lung cancer in Japanese male smokers. They also concluded that due to higher prevelence of the functionally active CYP2A6 gene in Caucasians compared to Asians, the genetic polymorphism of CYP2A6 may be a factor justifying the interindividual difference in predisposition to lung cancer among smokers. Consistent to the previous concept Benowitz et al. [57] concluded that the slower nicotine metabolism and therefore lower nicotine uptake per cigarette may explain lower incidence of lung cancer in Asians compared to Caucasians. In the present study we failed to find a significant association between CYP2A6 genotypes and risk of lung cancer. Our data is similar to the study by London & colleagues [39] who reported no significant relationship between the CYP2A6 inactive allele, mainly concentrating on the CYP2A6*2, and lung cancer risk.

Discordant results have been demonstrated on the association of CYP2A6 genetic polymorphisms and lung cancer risk [2, 26, 27, 29, 39, 58]. These contradictory results seem to be caused by the too small frequencies of the inactive alleles such as CYP2A6*2 and CYP2A6*4 in some studies to find a possible relationship with adequate statistical power [26, 29]. The protecting effect of CYP2A6 slow metabolism on lung cancer risk is more obvious in populations including subjects common to harbour CYP2A6 non-functional alleles as the Japanese compared to Caucasian & other populations who include individuals harbouring low frequency of CYP2A6 slow metabolizers. It is unclear whether the risk for lung cancer is mediated through the effect on smoking behavior or whether it also involves increased sensitivity to carcinogens present in cigarette smoke [59]. Liu & colleagues [60] suggested that decreasing or abolishing the activity of the CYP2A6 by means of specific inhibitors might prevent the frequency of occurrence of tobacco-induced lung cancer in smokers only. In this study, 5 out of 7 lung cancer cases (71.4%) with CYP2A6 slow metabolizer were non- smokers.

It is worth noting that our study has some limitations. First because the number of subjects is low, significant differences in smoking behaviors were not observed between those with and without CYP2A6*2 & CYP2A6*9. Further studies with larger population samples may present more detailed results. Second, we concentrated on only CYP2A6*2 & CYP2A6*9 genetic polymorphisms. The effects of other polymorphisms of CYP2A6 on smoking habits should be examined; CYP2A6*4 and *7 are also major functional polymorphisms.


Our study, in the setting of patients with lung cancer demonstrates that the frequency of slow metabolizer CYP2A6*2 and CYP2A6*9 are poor in the studied Egyptian population; who are non-smokers. Our findings did not suggest any association between CYP2A6 genotypes and risk of lung cancer.



Confidence interval

CYP2A6 :

Cytochrome P450 2A6


National Center for Biotechnology Information


National Cancer Institute


Non small cell lung cancer


Odds ratio


Small cell lung cancer


Standard deviation


Single nucleotide polymorphisms


  1. 1.

    Ferlay J, Soerjomataram I, Dikshit R, Eser S, Mathers C, Rebelo M, et al. Cancer incidence and mortality worldwide: sources, methods and major patterns in GLOBOCAN 2012. Int J Cancer. 2015;136:E359–86.

    CAS  Article  PubMed  Google Scholar 

  2. 2.

    Ariyoshi N, Miyamoto M, Umetsu Y, Kunitoh H, Dosaka-Akita H, Sawamura Y-I, et al. Genetic polymorphism of CYP2A6 gene and tobacco-induced lung cancer risk in male smokers. Cancer Epidemiol Biomark Prev. 2002;11:890–4.

    CAS  Google Scholar 

  3. 3.

    Nakajima M, Yamamoto T, Nunoya K, Yokoi T, Nagashima K, Inoue K, et al. Role of human cytochrome P4502A6 in C-oxidation of nicotine. Drug Metab Dispos. 1996;24:1212–7.

    CAS  PubMed  Google Scholar 

  4. 4.

    Iscan M, Rostami H, Iscan M, Güray T, Pelkonen O, Rautio A. Interindividual variability of coumarin 7-hydroxylation in a Turkish population. Eur J Clin Pharmacol. 1994;47:315–8.

    CAS  Article  PubMed  Google Scholar 

  5. 5.

    Rautio A, Kraul H, Kojo A, Salmela E, Pelkonen O. Interindividual variability of coumarin 7-hydroxylation in healthy volunteers. Pharmacogenetics. 1992;2:227–33.

    CAS  Article  PubMed  Google Scholar 

  6. 6.

    Fujieda M, Yamazaki H, Saito T, Kiyotani K, Gyamfi MA, Sakurai M, et al. Evaluation of CYP2A6 genetic polymorphisms as determinants of smoking behavior and tobacco-related lung cancer risk in male Japanese smokers. Carcinogenesis. 2004;25:2451–8.

    CAS  Article  PubMed  Google Scholar 

  7. 7.

    Kumondai M, Hosono H, Orikasa K, Arai Y, Arai T, Sugimura H, et al. Genetic polymorphisms of CYP2A6 in a case-control study on bladder Cancer in Japanese smokers. Biol Pharm Bull. 2016;39:84–9.

    Article  PubMed  Google Scholar 

  8. 8.

    Yamano S, Tatsuno J, Gonzalez FJ. The CYP2A3 gene product catalyzes coumarin 7-hydroxylation in human liver microsomes. Biochemistry (Mosc). 1990;29:1322–9.

    CAS  Article  Google Scholar 

  9. 9.

    Kitagawa K, Kunugita N, Kitagawa M, Kawamoto T. CYP2A6*6, a novel polymorphism in cytochrome p450 2A6, has a single amino acid substitution (R128Q) that inactivates enzymatic activity. J Biol Chem. 2001;276:17830–5.

    CAS  Article  PubMed  Google Scholar 

  10. 10.

    Pitarque M, von Richter O, Oke B, Berkkan H, Oscarson M, Ingelman-Sundberg M. Identification of a single nucleotide polymorphism in the TATA box of the CYP2A6 gene: impairment of its promoter activity. Biochem Biophys Res Commun. 2001;284:455–60.

    CAS  Article  PubMed  Google Scholar 

  11. 11.

    Xu C, Rao YS, Xu B, Hoffmann E, Jones J, Sellers EM, et al. An in vivo pilot study characterizing the new CYP2A6*7, *8, and *10 alleles. Biochem Biophys Res Commun. 2002;290:318–24.

    CAS  Article  PubMed  Google Scholar 

  12. 12.

    Yoshida R, Nakajima M, Watanabe Y, Kwon J-T, Yokoi T. Genetic polymorphisms in human CYP2A6 gene causing impaired nicotine metabolism. Br J Clin Pharmacol. 2002;54:511–7.

    CAS  Article  PubMed  PubMed Central  Google Scholar 

  13. 13.

    Minematsu N, Nakamura H, Iwata M, Tateno H, Nakajima T, Takahashi S, et al. Association of CYP2A6 deletion polymorphism with smoking habit and development of pulmonary emphysema. Thorax. 2003;58:623–8.

    CAS  Article  PubMed  PubMed Central  Google Scholar 

  14. 14.

    Oscarson M, Gullstén H, Rautio A, Bernal ML, Sinues B, Dahl ML, et al. Genotyping of human cytochrome P450 2A6 (CYP2A6), a nicotine C-oxidase. FEBS Lett. 1998;438:201–5.

    CAS  Article  PubMed  Google Scholar 

  15. 15.

    Kitagawa K, Kunugita N, Katoh T, Yang M, Kawamoto T. The significance of the homozygous CYP2A6 deletion on nicotine metabolism: a new genotyping method of CYP2A6 using a single PCR–RFLP. Biochem Biophys Res Commun. 1999;262:146–51.

    CAS  Article  PubMed  Google Scholar 

  16. 16.

    Malaiyandi V, Sellers EM, Tyndale RF. Implications of CYP2A6 genetic variation for smoking behaviors and nicotine dependence. Clin Pharmacol Ther. 2005;77:145–58.

    CAS  Article  PubMed  Google Scholar 

  17. 17.

    Nakajima M, Fukami T, Yamanaka H, Higashi E, Sakai H, Yoshida R, et al. Comprehensive evaluation of variability in nicotine metabolism and CYP2A6 polymorphic alleles in four ethnic populations. Clin Pharmacol Ther. 2006;80:282–97.

    CAS  Article  PubMed  Google Scholar 

  18. 18.

    Oscarson M, McLellan RA, Gullstén H, Agúndez JA, Benítez J, Rautio A, et al. Identification and characterisation of novel polymorphisms in the CYP2A locus: implications for nicotine metabolism. FEBS Lett. 1999;460:321–7.

    CAS  Article  PubMed  Google Scholar 

  19. 19.

    Schoedel KA, Hoffmann EB, Rao Y, Sellers EM, Tyndale RF. Ethnic variation in CYP2A6 and association of genetically slow nicotine metabolism and smoking in adult Caucasians. Pharmacogenetics. 2004;14:615–26.

    CAS  Article  PubMed  Google Scholar 

  20. 20.

    Iwahashi K, Waga C, Takimoto T. Whole deletion of CYP2A6 gene (CYP2A6AST;4C) and smoking behavior. Neuropsychobiology. 2004;49:101–4.

    CAS  Article  PubMed  Google Scholar 

  21. 21.

    López-Flores LA, Pérez-Rubio G, Falfán-Valencia R. Distribution of polymorphic variants of CYP2A6 and their involvement in nicotine addiction. EXCLI J. 2017;16:174–96.

    PubMed  PubMed Central  Google Scholar 

  22. 22.

    Minematsu N, Nakamura H, Furuuchi M, Nakajima T, Takahashi S, Tateno H, et al. Limitation of cigarette consumption by CYP2A6*4, *7 and *9 polymorphisms. Eur Respir J. 2006;27:289–92.

    CAS  Article  PubMed  Google Scholar 

  23. 23.

    Mwenifumbo JC, Tyndale RF. Genetic variability in CYP2A6 and the pharmacokinetics of nicotine. Pharmacogenomics. 2007;8:1385–402.

    CAS  Article  PubMed  Google Scholar 

  24. 24.

    Park SL, Tiirikainen MI, Patel YM, Wilkens LR, Stram DO, Le Marchand L, et al. Genetic determinants of CYP2A6 activity across racial/ethnic groups with different risks of lung cancer and effect on their smoking intensity. Carcinogenesis. 2016;37:269–79.

    Article  PubMed  PubMed Central  Google Scholar 

  25. 25.

    Emamghoreishi M, Bokaee H-R, Keshavarz M, Ghaderi A, Tyndale RF. CYP2A6 allele frequencies in an Iranian population. Arch Iran Med. 2008;11:613–7.

  26. 26.

    Loriot MA, Rebuissou S, Oscarson M, Cenée S, Miyamoto M, Ariyoshi N, et al. Genetic polymorphisms of cytochrome P450 2A6 in a case-control study on lung cancer in a French population. Pharmacogenetics. 2001;11:39–44.

    CAS  Article  PubMed  Google Scholar 

  27. 27.

    Miyamoto M, Umetsu Y, Dosaka-Akita H, Sawamura Y, Yokota J, Kunitoh H, et al. CYP2A6 gene deletion reduces susceptibility to lung cancer. Biochem Biophys Res Commun. 1999;261:658–60.

    CAS  Article  PubMed  Google Scholar 

  28. 28.

    Takeuchi H, Saoo K, Yokohira M, Ikeda M, Maeta H, Miyazaki M, et al. Pretreatment with 8-methoxypsoralen, a potent human CYP2A6 inhibitor, strongly inhibits lung tumorigenesis induced by 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone in female a/J mice. Cancer Res. 2003;63:7581–3.

    CAS  PubMed  Google Scholar 

  29. 29.

    Tan W, Chen GF, Xing DY, Song CY, Kadlubar FF, Lin DX. Frequency of CYP2A6 gene deletion and its relation to risk of lung and esophageal cancer in the Chinese population. Int J Cancer. 2001;95:96–101.

    CAS  Article  PubMed  Google Scholar 

  30. 30.

    Wang H, Tan W, Hao B, Miao X, Zhou G, He F, et al. Substantial reduction in risk of lung adenocarcinoma associated with genetic polymorphism in CYP2A13, the most active cytochrome P450 for the metabolic activation of tobacco-specific carcinogen NNK. Cancer Res. 2003;63:8057–61.

    CAS  PubMed  Google Scholar 

  31. 31.

    Ezzeldin N, El-Lebedy D, Darwish A, El-Bastawisy A, Hassan M, Abd El-Aziz S, et al. Genetic polymorphisms of human cytochrome P450 CYP1A1 in an Egyptian population and tobacco-induced lung cancer. Genes Environ. 2017;39:7.

    Article  PubMed  PubMed Central  Google Scholar 

  32. 32.

    Vasconcelos GM, Struchiner CJ, Suarez-Kurtz G. CYP2A6 genetic polymorphisms and correlation with smoking status in Brazilians. Pharmacogenomics J. 2005;5:42–8.

    CAS  Article  PubMed  Google Scholar 

  33. 33.

    Çok I, Kocabaş NA, Cholerton S, Karakayal AE, Şardaş S. Dtermination of coumarin metabolism in Turkish population. Hum Exp Toxicol. 2001;20:179–84.

    Article  PubMed  Google Scholar 

  34. 34.

    Chen GF, Tang YM, Green B, Lin DX, Guengerich FP, Daly AK, et al. Low frequency of CYP2A6 gene polymorphism as revealed by a one-step polymerase chain reaction method. Pharmacogenetics. 1999;9:327–32.

    CAS  Article  PubMed  Google Scholar 

  35. 35.

    Nakajima M, Kwon JT, Tanaka N, Zenta T, Yamamoto Y, Yamamoto H, et al. Relationship between interindividual differences in nicotine metabolism and CYP2A6 genetic polymorphism in humans. Clin Pharmacol Ther. 2001;69:72–8.

    CAS  Article  PubMed  Google Scholar 

  36. 36.

    Paschke T, Riefler M, Schuler-Metz A, Wolz L, Scherer G, McBride CM, et al. Comparison of cytochrome P450 2A6 polymorphism frequencies in Caucasians and African-Americans using a new one-step PCR-RFLP genotyping method. Toxicology. 2001;168:259–68.

    CAS  Article  PubMed  Google Scholar 

  37. 37.

    Ando M, Hamajima N, Ariyoshi N, Kamataki T, Matsuo K, Ohno Y. Association of CYP2A6 gene deletion with cigarette smoking status in Japanese adults. J Epidemiol. 2003;13:176–81.

    Article  PubMed  Google Scholar 

  38. 38.

    Rao Y, Hoffmann E, Zia M, Bodin L, Zeman M, Sellers EM, et al. Duplications and defects in the CYP2A6 gene: identification, genotyping, and in vivo effects on smoking. Mol Pharmacol. 2000;58:747–55.

    CAS  Article  PubMed  Google Scholar 

  39. 39.

    London SJ, Idle JR, Daly AK, Coetzee GA. Genetic variation of CYP2A6, smoking, and risk of cancer. Lancet. 1999;353:898–9.

    CAS  Article  PubMed  Google Scholar 

  40. 40.

    Sabol SZ, Hamer DH. An improved assay shows no association between the CYP2A6 gene and Cigarette smoking behavior. Behav Genet. 1999;29:257–61.

    Article  Google Scholar 

  41. 41.

    Verde Z, Santiago C, Rodríguez González-Moro JM, de Lucas RP, López Martín S, Bandrés F, et al. “Smoking genes”: a genetic association study. PLoS One. 2011;6:e26668.

    CAS  Article  PubMed  PubMed Central  Google Scholar 

  42. 42.

    Gu DF, Hinks LJ, Morton NE, Day IN. The use of long PCR to confirm three common alleles at the CYP2A6 locus and the relationship between genotype and smoking habit. Ann Hum Genet. 2000;64(Pt 5):383–90.

    CAS  Article  PubMed  Google Scholar 

  43. 43.

    Lerman C, Jepson C, Wileyto EP, Patterson F, Schnoll R, Mroziewicz M, et al. Genetic variation in nicotine metabolism predicts the efficacy of extended-duration transdermal nicotine therapy. Clin Pharmacol Ther. 2010;87:553–7.

    CAS  Article  PubMed  PubMed Central  Google Scholar 

  44. 44.

    Lerman C, Tyndale R, Patterson F, Wileyto EP, Shields PG, Pinto A, et al. Nicotine metabolite ratio predicts efficacy of transdermal nicotine for smoking cessation. Clin Pharmacol Ther. 2006;79:600–8.

    CAS  Article  PubMed  Google Scholar 

  45. 45.

    Malaiyandi V, Lerman C, Benowitz NL, Jepson C, Patterson F, Tyndale RF. Impact of CYP2A6 genotype on pretreatment smoking behaviour and nicotine levels from and usage of nicotine replacement therapy. Mol Psychiatry. 2006;11:400–9.

    CAS  Article  PubMed  Google Scholar 

  46. 46.

    Strasser AA, Benowitz NL, Pinto AG, Tang KZ, Hecht SS, Carmella SG, et al. Nicotine metabolite ratio predicts smoking topography and carcinogen biomarker level. Cancer Epidemiol Biomark Prev. 2011;20:234–8.

    CAS  Article  Google Scholar 

  47. 47.

    Styn MA, Nukui T, Romkes M, Perkins KA, Land SR, Weissfeld JL. CYP2A6 genotype and smoking behavior in current smokers screened for lung cancer. Subst Use Misuse. 2013;48:490–4.

    Article  PubMed  PubMed Central  Google Scholar 

  48. 48.

    Wassenaar CA, Dong Q, Wei Q, Amos CI, Spitz MR, Tyndale RF. Relationship between CYP2A6 and CHRNA5-CHRNA3-CHRNB4 variation and smoking behaviors and lung cancer risk. J Natl Cancer Inst. 2011;103:1342–6.

    CAS  Article  PubMed  PubMed Central  Google Scholar 

  49. 49.

    Carter B, Long T, Cinciripini P. A meta-analytic review of the CYP2A6 genotype and smoking behavior. Nicotine Tob Res. 2004;6:221–7.

    CAS  Article  PubMed  Google Scholar 

  50. 50.

    Munafò M, Clark T, Johnstone E, Murphy M, Walton R. The genetic basis for smoking behavior: a systematic review and meta-analysis. Nicotine Tob Res. 2004;6:583–97.

    Article  PubMed  Google Scholar 

  51. 51.

    Smoking in Egypt | Egypt Independent. Accessed 18 Apr 2017.

  52. 52.

    Loffredo CA, Radwan GN, Eltahlawy EM, El-Setouhy M, Magder L, Hussein MH. Estimates of the prevalence of tobacco smoking in Egypt. Open J Epidemiol. 2015;05:129.

    Article  Google Scholar 

  53. 53.

    Le Marchand L, Sivaraman L, Pierce L, Seifried A, Lum A, Wilkens LR, et al. Associations of CYP1A1, GSTM1, and CYP2E1 polymorphisms with lung cancer suggest cell type specificities to tobacco carcinogens. Cancer Res. 1998;58:4858–63.

    CAS  PubMed  Google Scholar 

  54. 54.

    Wynder EL, Hoffmann D. Smoking and lung cancer: scientific challenges and opportunities. Cancer Res. 1994;54:5284–95.

    CAS  PubMed  Google Scholar 

  55. 55.

    Strasser AA, Malaiyandi V, Hoffmann E, Tyndale RF, Lerman C. An association of CYP2A6 genotype and smoking topography. Nicotine Tob Res. 2007;9:511–8.

    CAS  Article  PubMed  Google Scholar 

  56. 56.

    Wassenaar CA, Ye Y, Cai Q, Aldrich MC, Knight J, Spitz MR, et al. CYP2A6 reduced activity gene variants confer reduction in lung cancer risk in African American smokers--findings from two independent populations. Carcinogenesis. 2015;36:99–103.

    CAS  Article  PubMed  Google Scholar 

  57. 57.

    Benowitz NL, Pérez-Stable EJ, Herrera B, Jacob P. Slower metabolism and reduced intake of nicotine from cigarette smoking in Chinese-Americans. J Natl Cancer Inst. 2002;94:108–15.

    Article  PubMed  Google Scholar 

  58. 58.

    Wang D, Gaba RC, Jin B, Riaz A, Lewandowski RJ, Ryu RK, et al. Intraprocedural transcatheter intra-arterial perfusion MRI as a predictor of tumor response to chemoembolization for hepatocellular carcinoma. Acad Radiol. 2011;18:828–36.

    Article  PubMed  PubMed Central  Google Scholar 

  59. 59.

    Raunio H, Rahnasto-Rilla M. CYP2A6: genetics, structure, regulation, and function. Drug Metabol Drug Interact. 2012;27:73–88.

    CAS  Article  PubMed  Google Scholar 

  60. 60.

    Liu T, Xie C-B, Ma W-J, Chen W-Q. Association between CYP2A6 genetic polymorphisms and lung cancer: a meta-analysis of case-control studies. Environ Mol Mutagen. 2013;54:133–40.

    CAS  Article  PubMed  Google Scholar 

Download references


We would like to thank Science & Technology development Fund in Egypt (STDF) for the financial support of this study.


This study was supported financially by the Science and Technology Development Fund (STDF), Egypt, Grant No 5016. The funding body had no role in the design of the study and collection, analysis, and interpretation of data and in writing the manuscript.

Availability of data and materials

All data generated and/or analyzed during this study are available from the corresponding author upon reasonable request.

Author information




All authors contributed to the present study. NE designed the study, AD & AE collected the samples & the clinicopathological data, DE, SA, and MH performed the molecular analysis, AS analyzed the data, NE, DE & AD wrote the manuscript. All authors have read, revised & approved the final version of the manuscript.

Corresponding author

Correspondence to Amira Darwish.

Ethics declarations

Ethics approval and consent to participate

The study protocol &the informed consent form were submitted for approval by Medical Research Ethics Committee (MREC) of National Research Centerof Egypt prior to the study commencement, with approval granted in January 2014 (Ref,-NO. 14008).

All subjects were aware of the study protocol and gave written informed consent.

Competing interests

The authors declare that they have no competing interests.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (, which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver ( applies to the data made available in this article, unless otherwise stated.

Reprints and Permissions

About this article

Verify currency and authenticity via CrossMark

Cite this article

Ezzeldin, N., El-Lebedy, D., Darwish, A. et al. Association of genetic polymorphisms CYP2A6*2 rs1801272 and CYP2A6*9 rs28399433 with tobacco-induced lung Cancer: case-control study in an Egyptian population. BMC Cancer 18, 525 (2018).

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI:


  • Lung cancer
  • CYP2A6
  • CYP2A6*2
  • CYP2A6*9
  • Polymorphism
  • Tobacco smoking
  • Nicotine metabolism
  • Egyptian