Skip to main content
Download PDF

CSPG4P12 polymorphism served as a susceptibility marker for esophageal cancer in Chinese population

BMC Cancer volume 24, Article number: 729 (2024) Cite this article

Abstract

Background

Chondroitin sulfate proteoglycan 4 pseudogene 12 (CSPG4P12) has been implicated in the pathogenesis of various cancers. This study aimed to evaluate the association of the CSPG4P12 polymorphism with esophageal squamous cell carcinoma (ESCA) risk and to explore the biological impact of CSPG4P12 expression on ESCA cell behavior.

Methods

A case-control study was conducted involving 480 ESCA patients and 480 healthy controls to assess the association between the rs8040855 polymorphism and ESCA risk. The CSPG4P12 rs8040855 genotype was identified using the TaqMan-MGB probe method. Logistic regression model was used to evaluate the association of CSPG4P12 SNP with the risk of ESCA by calculating the odds ratios (OR) and 95% confidence intervals (95%CI ). The effects of CSPG4P12 overexpression on cell proliferation, migration, and invasion were examined in ESCA cell lines. Co-expressed genes were identified via the CBioportal database, with pathway enrichment analyzed using SangerBox. The binding score of CSPG4P12 to P53 was calculated using RNA protein interaction prediction (RPISeq). Additionally, Western Blot analysis was performed to investigate the impact of CSPG4P12 overexpression on the P53/PI3K/AKT signaling pathway.

Results

The presence of at least one rs8040855 G allele was associated with a reduced susceptibility to ESCA compared to the CC genotype (OR = 0.51, 95%CI = 0.28–0.93, P = 0.03). Stratification analysis revealed that the CSPG4P12 rs8040855 C allele significantly decreased the risk of ESCA among younger individuals (≤ 57 years) and non-drinkers (OR = 0.31, 95%CI = 0.12–0.77, P = 0.01; OR = 0.42, 95%CI=0.20–0.87, P = 0.02, respectively). CSPG4P12 expression was found to be downregulated in ESCA tissues compared to adjacent normal tissues. Overexpression of CSPG4P12 in ESCA cells inhibited their proliferation, migration, and invasion capabilities. Furthermore, Western Blot analysis indicated that CSPG4P12 overexpression led to a reduction in PI3K and p-AKT protein expression levels. P53 silencing rescues the inhibitory effect of CSPG4P12 on p-AKT.

Conclusion

The CSPG4P12 rs8040855 variant is associated with reduced ESCA risk and the overexpression of CSPG4P12 inhibited the migration and invasion of ESCA cells by P53/PI3K/AKT pathway. These findings suggest that CSPG4P12 may serve as a novel biomarker for ESCA susceptibility and a potential target for therapeutic intervention.

Peer Review reports

Introduction

Esophageal cancer is the 6th most common cause of cancer-related deaths worldwide [1]. It is estimated that in 2022 there will be 346,633 new cases of esophageal cancer and 323,600 deaths in China, making it the fourth leading cause of cancer deaths [2]. Environmental factors, such as smoking, alcohol consumption and low intake of fresh fruits, have been found to be risk factors for esophageal cancer [3]. In addition to environmental factors, epidemiological and pathogenetic studies have confirmed that genetic variants also play an important role in the development of esophageal cancer [4]. In recent years, many genetic variants that affect the risk of developing esophageal cancer have been identified in genome-wide associated studies and candidate gene associated studies [5,6,7,8].

Most pseudogenes are long non-coding RNA(LncRNA), which are highly similar to parent genes but does not have protein-coding functions. Studied have found that pseudogene is involved in variety of physiological and biochemical processes, such as chromatin dynamics, gene expression, cell growth and their regulation [9]. During tumorigenesis, LncRNAs can regulate important cell signaling pathways such as the p53 pathway, at transcriptional and post-transcriptional level [10]. .

Single nucleotide polymorphism (SNP) is the most common variation in the human genome, accounting for more than 90% [11, 12]. Some genetic variants can affect the biological function of LncRNA by regulating its expression and contribute to the risk and prognosis of specific cancer [13,14,15]. For example, genetic variant, rs10505477 in LncRNA CASC8 was associated with the risk of lung cancer and could predict the response of lung cancer patients to platinum-based drug therapy [16].

Chondroitin sulfate proteoglycan 4 (CSPG4) is involved in the progression of many cancers, such as undifferentiated thyroid cancer, squamous cell carcinoma of the head and neck, and basal breast cancer [17, 18]. CSPG4 pseudogene 12 (CSPG4P12) is a LncRNA derived from a pseudogene, which is highly homologous to its parent gene CSPG4 [19]. Our research has previously shown that CSPG4P12 plays a role in inhibiting proliferation and metastasis of lung cancer cells while promoting apoptosis [20]. This discovery prompted us to search for regulatory variants within CSPG4P12 that could affect its expression levels. Among these, the rs8040855 variant emerged as a significant regulator of CSPG4P12 expression. Given the established impact of genetic variants on gene expression and the potential for such variations to connect single nucleotide polymorphisms (SNPs) with their target genes or transcripts [21,22,23], we chose to focus on rs8040855 in our study. To further explore the biological relevance of this finding, we investigated the expression levels of the CSPG4P12 gene in esophageal cancer tissues and adjacent normal tissues, revealing differential expression patterns that supported the potential functional impact of the rs8040855 polymorphism. These findings enabled us to discover the link between rs8040855 and esophageal cancer. In this study, we aim to investigate the correlation between the CSPG4P12 rs8040855 and the risk of esophageal cancer and to explore the effect of CSPG4P12 in the development of esophageal cancer.

Materials and methods

Participants in the population study

This case-control study involved in 480 patients with esophageal cancer and 480 healthy controls. All cases consisted of pathologically confirmed primary esophageal cancer patients who had not been treated with radiotherapy or chemotherapy. Controls were randomly selected from the eligible healthy population and who underwent a health check-up at the hospital during the same period. These healthy individuals had no previous history of tumor or blood relationship with cases. All participants were recruited at North China University of Science and Technology Affiliated Tangshan Gongren and Affiliated Tangshan Renmin Hospital (Tangshan, China) [24]. General demographic data and behavioral data of the study population were collected by reviewing medical records and questionnaire methods [7]. This study was approved by the Institutional Review Board of North China University of Science and Technology (No.2,022,027). All participants signed a written informed consent form.

DNA extraction and CSPG4P12 rs8040855 genotype determination

DNA from the peripheral blood of all participants was extracted by using the blood extraction kit (TIANGEN Biotechnology, Beijing, China). All subjects were genotyped by using TaqMan-MGB probe. Primers were listed as follows: rs8040855F: 5’-AAGGCTTCCTTGTGACACAGAAG-3’, rs8040855R: 5’-AGACCAAGGTTTGTATGCCCAC-3’, rs8040855-C Probe: FAM-CACATCTAGTTCTTTCTT-MGB, rs8040855-G Probe: VIC-CACATTACTCTTTCTT-MGB. PCR reaction was carried out in a 5 µl mixture containing 0.2 µl (2 µmol/L) of each probe, 0.15 µl (10 µmol/L) of each primer, and 1 µl (0.1–20 ng) of genomic DNA. 1×PCR mix (TaqMan Universal Master Mix II, ABI, USA). The PCR procedure consisted of an initial melting step of 2 min at 50 °C, 10 min at 95 °C, followed by 50 cycles of 15 s at 95 °C and then 1 min at 58 °C. ABI SDS 2.4 software was used to judge genotypes. Genotyping results were repeated with 10% of the samples. Blank controls were set in each plate to avoid erroneous results due to contamination.

The construction of CSPG4P12 overexpression vector

The CSPG4P12-pUC57 (7.54 kb) plasmid was Synthesized from Changzhou Ruibo Biotechnology (Jiangsu, China). In brief, CSPG4P12 (ENST00000558282.5; CSPG4P12-201; 4853 bp) was amplified using KOD FX (cat. no. KFX-101; TOYOBO, Osaka, Japan), and the following primers (SinoGenoMax, Beijing, China): 5’-CTAGTCTAGACACCTGGGCACCAACCTC-3’ (with XbaI cutting site) and 5’-ACGCGTCGACATAGAAAACAGCCCCAACCAG-3’ (with SaII cutting site). The thermocycling conditions: Pre-denaturation at 95˚C for 3 min; followed by 25 cycles at 95˚C for 25 s, at 60˚C for 20 s, and 72˚C for 40 s; final extension at 72˚C for 1 min. The PCR product was recombined into the pUC57 vector to generate the CSPG4P12 overexpression plasmid (CSPG4P12-pUC57), which was verified by Sanger sequencing.

Cell culture and plasmid treatment

Esophageal cancer cells (KYSE-30 and TE-10) (Procell Life Science & Technology, Wuhan, China) were cultured in RPMI 1640 medium (Thermo Fisher Scientific, Waltham, MA, USA) supplemented with 10% FBS (Zhejiang Tianhang Biotechnology, Zhejiang, China) at 37˚C with 5% CO2. The cells were regularly tested for mycoplasma contamination. Cells were seeded into six‑well plates at a density of 1 × 106 cells/well. When cells reach 80% confluency, CSPG4P12‑pUC57 or empty plasmid (pUC57) were transfected into KYSE-30 and TE-10 cells using Lipofectamine® 2000 (Thermo Fisher Scientific, Waltham, MA, USA) for 5 h at 37˚C. Cells were then harvested for further analysis after 24 h. The transfected cells continued to be cultured in with or without 20 µM/L PFT-α (MedChemExpress, New Jersey, USA) for 24 h.

Total RNA extraction and the detection of CSPG4P12 mRNA

To detect CSPG4P12 RNA expression, total RNA was extracted from the cells using the TRIzol® reagent (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s protocol. The RNA was then treated with DNase I (Thermo Fisher Scientific, Waltham, MA, USA) to remove any residual genomic DNA contamination. The DNase-treated RNA was then reverse-transcribed into cDNA using the RevertAid First Strand cDNA Synthesis kit (Thermo Fisher Scientific, Waltham, MA, USA). The cDNA was used as a template for real-time fluorescence quantitative PCR to measure CSPG4P12 expression. For SYBR Green-based qPCR, the 10µl reaction included 100 ng of cDNA, 5µl of 2×Power SYBR‑Green PCR Master Mix (Thermo Fisher Scientific, Waltham, MA, USA) in a 7900HT Fast Real‑Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA) with GAPDH as the internal reference. The primer pairs for RT‑qPCR are CSPG4P12 F/CSPG4P12-R (5’‑ATGGACCAGTACCCCACACG‑3’/ 5’‑CCCTGCCTCTAGCCATTGAC‑3’) and GAPDH- F/GAPDH-R (5’‑CTGGGCTACACTGAGGACC‑3’/5’‑AAGTGGTCGTTGAGGGCAATG‑3’). The thermocycling conditions were as follows: pre‑denaturation at 95˚C for 2 min; followed by 40 cycles at 95˚C for 15 s and at 59˚C for 1 min; final extension at 72˚C for 10 min. The relative expression levels of CSPG4P12 were calculated using the 2‑∆∆Ct method [25].

Cell biology phenotypes

CCK-8 assay was used to detect cell viability. A total of 1 × 104 transfected cells/well were seeded into 96-well plates. Incubated cells at 37˚C for 24, 48 and 72 h and then let stand at 37˚C for 1 h after adding 10 µl CCK-8 reagent (Dojindo, Kyushu, Japan). The absorbance at 450 nm was measured using the Infinite M200 PRO instrument (Tecan, Männedorf, Switzerland). Cell migration and invasion were determined by Transwell assay. For invasion assay, the upper chamber of Transwell was precoated with Matrigel (Corning, NY, USA) for 5 hours at 37 °C. Then, 1.5 × 105 cells were seeded in 200µL RPMI 1640 medium into an 8 μm pore size upper chamber (JET BIOFIL, Guangzhou, China) for 48 h. Matrigel (8–11 mg/ml) was mixed with RPMI 1640 medium in a 1:8 ratio, and the final concentration of Matrigel used in the invasion assay was 0.9 to 1.2 mg/ml. For migration assay, cells were directed seeded in the upper chamber without Matrigel. The lower chamber is filled with 600 µl RPMI 1640 medium supplemented with 20% FBS.

Bioinformatics analysis

Online ncRNA-eQTL program (http://ibi.hzau.edu.cn/ncRNA-eQTL/index.php) was used to analyze the effect of rs8040855 on the expression level of CSPG4P12. All biological analysis data were downloaded from UCSC XENA (https://xenabrowser.net/datapages/). DESeq2 was used to analyze differences in CSPG4P12 expression between esophageal cancer tissues and adjacent normal tissues, setting |log2(FC)|>1 & P < 0.05 as the thresholds for difference analysis. Cox regression analysis was used to analyze the effect of CSPG4P12 expression level on the prognosis of patients. R survival [v 3.3.1] and ggplot2 [v 3.3.6] were used for this analysis. The cBioportal database (https://www.cbioportal.org) was used to screen for CSPG4P12 co-expressed genes. The q-Value < 0.05 was used as a screening condition. Sangerbox (http://vip.sangerbox.com/) online website was used for enrichment analysis of the signal pathways acted by CSPG4P12 co-expressed genes. The binding score of CSPG4P12 to P53 was calculated using RNA protein interaction prediction (RPISeq) (http://pridb.gdcb.iastate.edu/RPISeq/).

Western blotting analysis

The esophageal cancer cells were lysed with radioimmunoprecipitation assay (RIPA) buffer (Thermo Fisher Scientific, Waltham, MA, USA). The Pierce BCA Protein Assay Kit (Solarbio, Beijing, China) was used to detect protein concentrations. The samples underwent separation through 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), before being transferred to a polyvinylidene difluoride (PVDF) membrane (Millipore, Billerica, MA, USA) for additional analysis. Following a 2-hour blocking step at room temperature with 5% skimmed milk, the membrane was exposed to the primary antibody overnight at 4 °C. Subsequently, the membrane was washed and incubated with a horseradish peroxidase (HRP)-conjugated secondary antibody for 2 h at room temperature. The specific protein was subsequently visualized using enhanced chemiluminescence (ECL) luminescence reagents (Amersham, Slough, Buckinghamshire, UK). Due to the constraints of our experimental setup, some blots were cut prior to hybridization with antibodies to facilitate simultaneous probing for multiple targets. This step was necessary to ensure the efficient use of samples and reagents. Consequently, full-length images of some blots are not available. Where full-length images are not available, we have included the original blots with visible membrane edges in the Supplementary Information file. β-Actin was applied as a reference control. The following primary antibodies were used: anti − PI3K (1:1,000 dilution; ab191606; Abcam, Cambridge, UK), anti −AKT (1:10,000 dilution; ab179463; Abcam), anti − p-AKT (1:1,000 dilution; ab192623; Abcam), anti − NF-κB p65 (1:5,000 dilution; ab32536; Abcam), anti − p- NF-κB p65 (1:1,000 dilution; ab76302; Abcam), and P53 Polyclonal Antibody (1:2,000 dilution; 10442-1-AP; Proteintech).

Statistical analysis

SPSS 23.0 software was used for statistical analysis. Chi-square tests were used to compare the distributions of categorical variables. Odds ratios (OR), and 95% confidence intervals (CI) were calculated to evaluate the association of rs8040855 genotype with the susceptibility to esophageal cancer using unconditional logistic regression. All statistical tests were two-sided t-tests. P < 0.05 is considered statistically significant.

Results

Differential expression of CSPG4P12 in ESCA and SNP selection

Bioinformatic analysis revealed that the pseudogene CSPG4P12 is poorly expressed in many types of cancer tissue, including esophageal cancer (Fig. 1a and b). Our ncRNA-eQTL result showed that rs8040855 CG or GG genotype significantly increases the expression level of CSPG4P12 compared to the CC genotype. (Fig. 1c).

Fig. 1
figure 1

Expression of CSPG4P12 in ESCA (a) Pan-cancer analysis of CSPG4P12 differential expression. (b) Expression level of CSPG4P12 in ESCA tumor tissues. (c) Effect of CSPG4P12 rs8040855 genotyping on the expression level of CSPG4P12

Full size image

Correlation analysis between CSPG4P12 rs8040855 polymorphism and the risk of ESCA

The general demographic information of the subjects is listed in Table 1. There was no significant difference in gender and age composition between the cases and controls. More people smoked cigarette (58.3%) and drank alcohol (30.8%) in case group (32.5%, 21.7%). In normal controls, the frequency of CSPG4P12 rs8040855 CC and CG genotype was 93.1% and 6.9%, respectively, which was in line with Hardy-Weinberg equilibrium (χ2 = 0.61, P = 0.44). It is worth noting that we did not detect the GG genotype in normal controls. The CSPG4P12 rs8040855 affected the risk of susceptibility to esophageal cancer (Table 2). The carriers with rs8040855 CG or GG genotype had reduced susceptibility to esophageal cancer compared to CC genotype with OR (95%CI) of 0.51(0.28–0.93) (P = 0.03).

Table 1 Distributions of select characteristics in cases and control subjects
Full size table
Table 2 Gene polymorphism of CSPG4P12 and their association with ESCA
Full size table

Stratification analysis of the association of CSPG4P12 variant with the risk of esophageal cancer

The stratification analysis results were list in Table 3. The carriers with CG or GG genotype had a lower risk of esophageal cancer compared to CC genotype in the younger age group (age ≤ 57) (OR = 0.31, 95%CI = 0.12–0.77, P = 0.01), but not in the elder age group (age > 57). The individuals with CG or GG carriers had a lower risk of esophageal cancer compared to CC genotypes among non-drinkers, (OR = 0.42, 95%CI: 0.20–0.87, P = 0.02), but not among drinkers.

Table 3 Stratified analysis between CSPG4P12 rs8040855 genotypes and ESCA risk
Full size table

Overexpression of CSPG4P12 inhibits ESCA cell proliferation and migration-invasive ability

We found that the low expression of CSPG4P12 was associated with the poor prognosis of esophageal cancer based on UCSC XENA data. (Fig. 2a). We then constructed CSPG4P12 overexpression vector to explore its role in the development of esophageal cancer. CSPG4P12 expression in KYSE-30 (73-fold) and TE-10 (37-fold) was elevated by 73- and 37-fold respectively, after transfected CSPG4P12-pUC57 overexpression plasmid. (Fig. 2b). CCK-8 assay showed that the overexpression of CSPG4P12 significantly reduced the viability of KYSE-30 and TE-10 cells in a time dependent manner (P < 0.05) (Fig. 2c and d). Transwell assay indicated that CSPG4P12 significantly decreased the migration and invasion ability of esophageal cancer cells (P < 0.01) (Fig. 3).

Overexpression of CSPG4P12 induces P53 inhibition of PI3K/AKT

To further explore the mechanism of CSPG4P12 in ESCA, we enriched the signal pathways in which CSPG4P12 co-expressed genes acted. The results showed that CSPG4P12 co-expressed genes mainly acted on signal pathways such as PI3K/AKT and NF-KB, which are closely related to tumors (Fig. 4a). The results of protein blotting experiments revealed that overexpression of CSPG4P12 could reduce the levels of PI3K and p-AKT protein expression but did not affect the level of NF-κB protein expression (Fig. 4b and c). Further interaction analysis showed that CSPG4P12 may bind to P53 at RF and SVM scores greater than 0.6. And our previous study found that overexpression of CSPG4P12 significantly increased P53 expression (Fig. 4.d). We analyzed the effect of CSPG4P12 on p-AKT by inhibiting P53. The results showed that silencing of P53 could effectively rescue the inhibitory effect of CSPG4P12 on p-AKT (Fig. 4.e). These studies demonstrated that overexpression of CSPG4P12 inhibited the migration and invasion ability of ESCA cells by inducing P53 to inhibit the PI3K/AKT signaling pathway.

Fig. 2
figure 2

The effect of CSPG4P12 on ESCA (a) Low expression of CSPG4P12 is associated with poor prognosis of ESCA. (b) CSPG4P12 was overexpressed in ESCA cells. (c, d) Overexpression of CSPG4P12 inhibited the proliferation of ECSA cells

Full size image
Fig. 3
figure 3

Effects of CSPG4P12 overexpression on migratory and invasive abilities of ESCA cells (a) Detection of ESCA cell migration using Transwell assay (magnification, x100); (b) the results of which were quantified. (c) Detection of ESCA cell invasion using Transwell assay (magnification, x100); (d) the results of which were quantified

Full size image
Fig. 4
figure 4

Effects of CSPG4P12 overexpression on P53/PI3K/AKT. (a) Enrichment analysis of signal pathways for CSPG4P12 co-expressed genes action; (b) Detection of PI3K/AKT protein expression using western blotting; (c) Detection of NF-κB protein expression using western blotting; (d) The binding probability of CSPG4P12 and P53 was predicted by RPISeq database; (e) P53 silencing rescues the inhibitory effect of CSPG4P12 on p-AKT

Full size image

Discussion

Pseudogenes are involved in the process of esophageal cancer development [26, 27]. For example, MALAT1 was found to regulate esophageal cancer growth by modifying the ATM-CHK2 pathway in esophageal cancer [28]. The knockdown of MALAT1 in esophageal cancer can inhibit the migration and invasion ability of esophageal cancer cells. CSPG4P12, as a highly homologous pseudogene of CSPG4, most likely possesses a similar biological role to CSPG4 which has been demonstrated to play an important role in tumor cell growth and metastasis [17].

In this study, our data showed that the pseudogene CSPG4P12 is lowly expressed in esophageal cancer tissues compared to adjacent normal tissues. Similarly, our previous study found that CSPG4P12 expression was downregulated in NSCLC tissues [20]. This study also provided evidence that CSPG4P12 could inhibit the proliferation, migration, and invasion ability of esophageal cancer cells. The PI3K/AKT signal pathway is an intracellular signal transduction pathway that responds to extracellular signals to promote metabolism, proliferation, cell survival, growth and angiogenesis, and it is closely related to ESCA development [29, 30]. A study showed that G3BP1 deficiency could inhibit the proliferation, migration and invasion of ESCA cells through the PI3K/AKT pathway [31]. In addition, it was found that knockdown of DEAD-box 51 inhibited the tumor growth of ESCA through the PI3K/AKT pathway [32]. In addition, our finding showed a significant upregulation of the P53 protein upon overexpression of CSPG4P12. Although P53 is primarily known for its roles in cell cycle regulation and apoptosis, it can also report to negatively regulate the PI3K/AKT pathway [33]. This suggests that CSPG4P12 inhibits the proliferation and migratory invasive ability of ESCA cells by suppressing the PI3K/AKT pathway through increased P53 levels.

It is pivotal to highlight the significant findings from our previous studies that demonstrate the profound impact of CSPG4P12 overexpression on pivotal cellular pathways controlling cell cycle and apoptosis. Specifically, the overexpression of CSPG4P12 markedly enhances the expression of P53, a critical tumor suppressor gene [20]. The upregulation of P53 is known to promote cell cycle arrest and apoptosis, thus acting as a fundamental checkpoint in preventing tumor progression [34]. Concurrently, CSPG4P12 overexpression results in a significant reduction in the levels of Bcl-2 [20], an anti-apoptotic protein that typically contributes to cell survival and resistance to cell death mechanisms in cancer cells [35]. The decrease in Bcl-2 expression could lead to enhanced apoptotic activity within cells, further underscoring the potential of CSPG4P12 as a modulator of cell fate decisions. These observations suggest that CSPG4P12 may serve as a critical regulatory lncRNA in oncogenesis. In a hepatocellular carcinoma (HCC) study, researchers demonstrated that CSPG4P12, combining 5 other genes (BX537318.1, TMEM147, AC015908.3, CEBPZOS, and SRD5A3), served as the signature for prognostic evaluation of HCC [36]. All these studies revealed a potential biological role of CSPG4P12 in the development of various cancers. In our investigation into the role of CSPG4P12 lncRNA in esophageal cancer, we assessed its expression across various esophageal cancer cell lines. The analyses consistently revealed low expression levels of CSPG4P12 across all tested lines. Given this uniform low expression, we opted not to pursue knockdown experiments to study potential effects on the P53/PI3K/AKT signaling pathway. However, the importance of understanding the functional roles of CSPG4P12, particularly its interaction with the P53/PI3K/AKT pathway, cannot be fully understated. This pathway is crucial for numerous cellular processes, including growth, proliferation, and survival, and is often dysregulated in cancer. For future research, it would be advantageous to utilize esophageal cancer cell lines with naturally higher levels of CSPG4P12.

In this study, we also discovered the effect of genetic variants in CSPG4P12 gene on the susceptibility to esophageal cancer. To date, this is the first report on the association of CSPG4P12 polymorphism with the risk of any cancer. There is also no Chinese population data related to this polymorphism in NCBI database. In this study, we found that rs8040855 C > G variant significantly reduced the risk of esophageal cancer. This is consistent with our expression analysis result which showed that the change of rs8040855C to G increased the expression of CSPG4P12. We also addressed the expression of CSPG4P12 and its association with genetic polymorphisms in esophageal cancer using the online ncRNA-eQTL database due to the unavailability of direct tissue samples. As with any database derived from population studies, there are potential confounding factors such as age, gender, ethnicity, and environmental influences that might affect gene expression data but are not accounted for in eQTL analysis. Despite these limitations, utilizing ncRNA-eQTL data is a pragmatic interim solution that allows us to continue our research under current constraints. In our initial study design was primarily focused on establishing a genetic association between the CSPG4P12 rs8040855 variant and esophageal cancer risk, along with its impact on gene expression levels. Expanding the study to include direct functional analysis of this variant in cell lines would require a significant shift in our research focus and resources, which was not feasible at this stage. Recognizing this limitation, we will investigate the functional role of the CSPG4P12 rs8040855 variant in esophageal cancer in future research. These will be crucial for elucidating the molecular mechanisms by which the CSPG4P12 rs8040855 variant contributes to esophageal cancer pathogenesis and could reveal novel targets for therapeutic intervention.

Our result also presented that CSPG4P12 rs8040855 C > G genetic variant reduced the risk of esophageal cancer in non-drinkers, but not in drinkers. It is well known that alcohol consumption is a major risk factor for esophageal cancer [37, 38]. The ethanol in alcoholic beverages is metabolized into acetaldehyde, which has been classified as a human carcinogen by the International Agency for Research on Cancer [39]. In addition, the interaction between alcohol and genetic factors has been reported to have an effect on the risk of esophageal cancer [40]. In addition, genetic inheritance variations can reduce the risk of esophageal cancer in younger people. For example, it was found that the POLR2E rs3787016 C > T and HULC rs7763881 A > C genetic variants were factors in the reduced risk of esophageal cancer in the younger [41]. However, for this gene-environmental interaction result, a larger sample size are still needed.

Conclusion

In summary, this study investigated the relationship between the polymorphisms and expression of CSPG4P12 and ESCA risk based on a population-based case-control study design. The SNP rs8040855 genetic variation reduces the risk of ESCA. The rs8040855 C > G variant was related to the expression level of CSPG4P12. Moreover, the overexpression of CSPG4P12 inhibited the migration and invasion of ESCA cells by P53/ PI3K/AKT. CSPG4P12 may serve as a novel potential therapeutic target for ESCA. However, further studies in large populations and more functional investigations are warranted to validate the findings in this study.

Data availability

The datasets generated or analyzed during this study are included in this article.

Abbreviations

ESCA:

Esophageal cancer

LncRNA:

Long non-coding RNA

SNP:

Single nucleotide polymorphism

CSPG4:

Chondroitin sulfate proteoglycan 4

CSPG4P12:

CSPG4 pseudogene 12

OR:

Odd ratio

CI:

Confidence interval

CCK-8:

Cell Counting Kit-8 Assay

RT-qPCR:

Reverse Transcription- quantitative PCR

References

  1. Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, Bray F. Global Cancer statistics 2020: GLOBOCAN estimates of incidence and Mortality Worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2021;71(3):209–49.

    Article  PubMed  Google Scholar 

  2. Xia C, Dong X, Li H, Cao M, Sun D, He S, Yang F, Yan X, Zhang S, Li N, Chen W. Cancer statistics in China and United States, 2022: profiles, trends, and determinants. Chin Med J (Engl). 2022;135(5):584–90.

    Article  PubMed  Google Scholar 

  3. Abnet CC, Arnold M, Wei WQ. Epidemiology of esophageal squamous cell carcinoma. Gastroenterology. 2018;154(2):360–73.

    Article  PubMed  Google Scholar 

  4. Diao J, Bao J, Peng J, Mo J, Ye Q, He J. Correlation between NAD(P)H: quinone oxidoreductase 1 C609T polymorphism and increased risk of esophageal cancer: evidence from a meta-analysis. Ther Adv Med Oncol. 2017;9(1):13–21.

    Article  CAS  PubMed  Google Scholar 

  5. Chen WC, Brandenburg JT, Choudhury A, Hayat M, Sengupta D, Swiel Y, Babb de Villiers C, Ferndale L, Aldous C, Soo CC, et al. Genome-wide association study of esophageal squamous cell cancer identifies shared and distinct risk variants in African and Chinese populations. Am J Hum Genet. 2023;110(10):1690–703.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  6. Shao Y, Guo X, Zhao L, Shen Y, Niu C, Wei W, Liu F. A functional variant of the miR-15 family is Associated with a decreased risk of esophageal squamous cell carcinoma. DNA Cell Biol. 2020;39(9):1583–94.

    Article  CAS  PubMed  Google Scholar 

  7. Li J, Wu H, Gao H, Kou R, Xie Y, Zhang Z, Zhang X. TLR4 promoter rs1927914 variant contributes to the susceptibility of esophageal squamous cell carcinoma in the Chinese population. PeerJ. 2021;9:e10754.

    Article  PubMed  PubMed Central  Google Scholar 

  8. Shen Y, Shao Y, Ruan X, Zhu L, Zang Z, Wei T, Nakyeyune R, Wei W, Liu F. Genetic variant in mir-17-92 cluster binding sites is associated with esophageal squamous cell carcinoma risk in Chinese population. BMC Cancer. 2022;22(1):1253.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  9. Bhan A, Mandal SS. LncRNA HOTAIR: a master regulator of chromatin dynamics and cancer. Biochim Biophys Acta. 2015;1856(1):151–64.

    CAS  PubMed  PubMed Central  Google Scholar 

  10. Cheetham SW, Gruhl F, Mattick JS, Dinger ME. Long noncoding RNAs and the genetics of cancer. Br J Cancer. 2013;108(12):2419–25.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  11. Zhang Y, Chen B, Chen D, Wang Y, Lu Q, Tan J, Chen L, Zhou L, Tan W, Yang Y, Yuan Q. Electrical detection assay based on programmable nucleic acid probe for efficient single-nucleotide polymorphism identification. ACS Sens. 2023;8(5):2096–104.

    Article  CAS  PubMed  Google Scholar 

  12. Azizzadeh-Roodpish S, Garzon MH, Mainali S. Classifying single nucleotide polymorphisms in humans. Mol Genet Genomics. 2021;296(5):1161–73.

    Article  CAS  PubMed  Google Scholar 

  13. Gong J, Tian J, Lou J, Ke J, Li L, Li J, Yang Y, Gong Y, Zhu Y, Zhang Y, et al. A functional polymorphism in lnc-LAMC2-1:1 confers risk of colorectal cancer by affecting miRNA binding. Carcinogenesis. 2016;37(5):443–51.

    Article  CAS  PubMed  Google Scholar 

  14. Tang X, Gao Y, Yu L, Lu Y, Zhou G, Cheng L, Sun K, Zhu B, Xu M, Liu J. Correlations between lncRNA-SOX2OT polymorphism and susceptibility to breast cancer in a Chinese population. Biomark Med. 2017;11(3):277–84.

    Article  CAS  PubMed  Google Scholar 

  15. Du M, Wang W, Jin H, Wang Q, Ge Y, Lu J, Ma G, Chu H, Tong N, Zhu H, et al. The association analysis of lncRNA HOTAIR genetic variants and gastric cancer risk in a Chinese population. Oncotarget. 2015;6(31):31255–62.

    Article  PubMed  PubMed Central  Google Scholar 

  16. Hu L, Chen SH, Lv QL, Sun B, Qu Q, Qin CZ, Fan L, Guo Y, Cheng L, Zhou HH. Clinical significance of long non-coding RNA CASC8 rs10505477 polymorphism in Lung Cancer susceptibility, platinum-based chemotherapy response, and toxicity. Int J Environ Res Public Health 2016, 13(6).

  17. Wang X, Wang Y, Yu L, Sakakura K, Visus C, Schwab JH, Ferrone CR, Favoino E, Koya Y, Campoli MR, et al. CSPG4 in cancer: multiple roles. Curr Mol Med. 2010;10(4):419–29.

    Article  CAS  PubMed  Google Scholar 

  18. Egan CE, Stefanova D, Ahmed A, Raja VJ, Thiesmeyer JW, Chen KJ, Greenberg JA, Zhang T, He B, Finnerty BM, et al. CSPG4 is a potential therapeutic target in anaplastic thyroid Cancer. Thyroid. 2021;31(10):1481–93.

    CAS  PubMed  PubMed Central  Google Scholar 

  19. Wiest T, Hyrenbach S, Bambul P, Erker B, Pezzini A, Hausser I, Arnold ML, Martin JJ, Engelter S, Lyrer P, et al. Genetic analysis of familial connective tissue alterations associated with cervical artery dissections suggests locus heterogeneity. Stroke. 2006;37(7):1697–702.

    Article  PubMed  Google Scholar 

  20. Hu W, Wu H, Li A, Zheng X, Zhang W, Tian Q, Zhang X. Pseudogene CSPG4P12 affects the biological behavior of non–small cell lung cancer by Bcl–2/Bax mitochondrial apoptosis pathway. Exp Ther Med. 2022;24(6):734.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  21. Dai JY, Wang X, Wang B, Sun W, Jordahl KM, Kolb S, Nyame YA, Wright JL, Ostrander EA, Feng Z, Stanford JL. DNA methylation and cis-regulation of gene expression by prostate cancer risk SNPs. PLoS Genet. 2020;16(3):e1008667.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  22. Gallagher MD, Posavi M, Huang P, Unger TL, Berlyand Y, Gruenewald AL, Chesi A, Manduchi E, Wells AD, Grant SFA, et al. A dementia-Associated risk variant near TMEM106B alters chromatin Architecture and Gene Expression. Am J Hum Genet. 2017;101(5):643–63.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  23. Joehanes R, Zhang X, Huan T, Yao C, Ying SX, Nguyen QT, Demirkale CY, Feolo ML, Sharopova NR, Sturcke A, et al. Integrated genome-wide analysis of expression quantitative trait loci aids interpretation of genomic association studies. Genome Biol. 2017;18(1):16.

    Article  PubMed  PubMed Central  Google Scholar 

  24. Zhang Y, Zhang Z, Cao L, Lin J, Yang Z, Zhang X. A common CD55 rs2564978 variant is associated with the susceptibility of non-small cell lung cancer. Oncotarget. 2017;8(4):6216–21.

    Article  PubMed  Google Scholar 

  25. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 2001;25(4):402–8.

    Article  CAS  PubMed  Google Scholar 

  26. Wang Z, Ren B, Huang J, Yin R, Jiang F, Zhang Q. LncRNA DUXAP10 modulates cell proliferation in esophageal squamous cell carcinoma through epigenetically silencing p21. Cancer Biol Ther. 2018;19(11):998–1005.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  27. Lou W, Ding B, Fu P. Pseudogene-derived lncRNAs and their miRNA sponging mechanism in Human Cancer. Front Cell Dev Biol. 2020;8:85.

    Article  PubMed  PubMed Central  Google Scholar 

  28. Hu L, Wu Y, Tan D, Meng H, Wang K, Bai Y, Yang K. Up-regulation of long noncoding RNA MALAT1 contributes to proliferation and metastasis in esophageal squamous cell carcinoma. J Exp Clin Cancer Res. 2015;34(1):7.

    Article  PubMed  PubMed Central  Google Scholar 

  29. Luo Q, Du R, Liu W, Huang G, Dong Z, Li X. PI3K/Akt/mTOR signaling pathway: role in Esophageal Squamous Cell Carcinoma, Regulatory mechanisms and opportunities for targeted therapy. Front Oncol. 2022;12:852383.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  30. Li B, Xu WW, Lam AKY, Wang Y, Hu HF, Guan XY, Qin YR, Saremi N, Tsao SW, He QY, Cheung ALM. Significance of PI3K/AKT signaling pathway in metastasis of esophageal squamous cell carcinoma and its potential as a target for anti-metastasis therapy. Oncotarget. 2017;8(24):38755–66.

    Article  PubMed  PubMed Central  Google Scholar 

  31. Zhang LN, Zhao L, Yan XL, Huang YH. Loss of G3BP1 suppresses proliferation, migration, and invasion of esophageal cancer cells via Wnt/beta-catenin and PI3K/AKT signaling pathways. J Cell Physiol. 2019;234(11):20469–84.

    Article  CAS  PubMed  Google Scholar 

  32. Hu DX, Sun QF, Xu L, Lu HD, Zhang F, Li ZM, Zhang MY. Knockdown of DEAD-box 51 inhibits tumor growth of esophageal squamous cell carcinoma via the PI3K/AKT pathway. World J Gastroenterol. 2022;28(4):464–78.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  33. Stambolic V, MacPherson D, Sas D, Lin Y, Snow B, Jang Y, Benchimol S, Mak TW. Regulation of PTEN transcription by p53. Mol Cell. 2001;8(2):317–25.

    Article  CAS  PubMed  Google Scholar 

  34. Chen J. The cell-cycle arrest and apoptotic functions of p53 in Tumor initiation and progression. Cold Spring Harb Perspect Med. 2016;6(3):a026104.

    Article  PubMed  PubMed Central  Google Scholar 

  35. Warren CFA, Wong-Brown MW, Bowden NA. BCL-2 family isoforms in apoptosis and cancer. Cell Death Dis. 2019;10(3):177.

    Article  PubMed  PubMed Central  Google Scholar 

  36. Yang LI, Deng K, Mou Z, Xiong P, Wen J, Li J. Pathological images for personal medicine in Hepatocellular carcinoma: cross-talk of gene sequencing and pathological images. Oncol Res. 2022;30(5):243–58.

    Article  CAS  PubMed  Google Scholar 

  37. Oze I, Charvat H, Matsuo K, Ito H, Tamakoshi A, Nagata C, Wada K, Sugawara Y, Sawada N, Yamaji T, et al. Revisit of an unanswered question by pooled analysis of eight cohort studies in Japan: does cigarette smoking and alcohol drinking have interaction for the risk of esophageal cancer? Cancer Med. 2019;8(14):6414–25.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  38. Kitagawa Y, Uno T, Oyama T, Kato K, Kato H, Kawakubo H, Kawamura O, Kusano M, Kuwano H, Takeuchi H, et al. Esophageal cancer practice guidelines 2017 edited by the Japan Esophageal Society: part 1. Esophagus. 2019;16(1):1–24.

    Article  PubMed  Google Scholar 

  39. Re-evaluation of some. Organic chemicals, hydrazine and hydrogen peroxide. IARC Monogr Eval Carcinog risks Hum. 1999, 71 pt 1, pt 2, Pt 3(PT 1):1–1554.

  40. Suo C, Yang Y, Yuan Z, Zhang T, Yang X, Qing T, Gao P, Shi L, Fan M, Cheng H, et al. Alcohol intake interacts with functional genetic polymorphisms of Aldehyde dehydrogenase (ALDH2) and Alcohol dehydrogenase (ADH) to increase esophageal squamous cell Cancer risk. J Thorac Oncol. 2019;14(4):712–25.

    Article  CAS  PubMed  Google Scholar 

  41. Kang M, Sang Y, Gu H, Zheng L, Wang L, Liu C, Shi Y, Shao A, Ding G, Chen S, et al. Long noncoding RNAs POLR2E rs3787016 C/T and HULC rs7763881 A/C polymorphisms are associated with decreased risk of esophageal cancer. Tumour Biol. 2015;36(8):6401–8.

    Article  CAS  PubMed  Google Scholar 

Download references

Acknowledgements

Not applicable.

Funding

This study was supported by Tangshan Human Resources and Social Security Bureau (grant number: A202110007).

Author information

Authors and Affiliations

  1. School of Public Health, North China University of Science and Technology, Tangshan, China

    Hongxue Xu, Zhenbang Yang, Wenqian Hu, Xianlei Zhou & Xuemei Zhang

  2. College of Life Sciences, North China University of Science and Technology, Tangshan, China

    Hongxue Xu & Xuemei Zhang

  3. Hebei Key Laboratory of Occupational Health and Safety for Coal Industry, North China University of Science and Technology, Tangshan, China

    Hongxue Xu & Xuemei Zhang

  4. Affiliated Tangshan Gongren Hospital , North China University of Science and Technology, Tangshan, China

    Zhi Zhang

Authors
  1. Hongxue Xu
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Zhenbang Yang
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Wenqian Hu
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Xianlei Zhou
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Zhi Zhang
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Xuemei Zhang
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

X.Z., Z.Y. and H.X. substantially contributed to the conception or design of the work; H.X. and W.H. performed the experiments; H.X. and X.Z. contributed to data acquisition and statistical analysis; H.X. drafted the manuscript; materials needed for the study were provided by Z.Z.; X.Z. revised the manuscript critically for important intellectual content and made the decision to submit for publication. All authors have read and approved the manuscript.

Corresponding author

Correspondence to Xuemei Zhang.

Ethics declarations

Ethics approval and consent to participate

This study was approved by the Institutional Review Board of North China University of Science and Technology (No.2022027). The written informed consent was obtained from each participant enrolled in this study.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Electronic supplementary material

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Xu, H., Yang, Z., Hu, W. et al. CSPG4P12 polymorphism served as a susceptibility marker for esophageal cancer in Chinese population. BMC Cancer 24, 729 (2024). https://doi.org/10.1186/s12885-024-12475-4

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s12885-024-12475-4

Keywords

BMC Cancer

ISSN: 1471-2407

Contact us