Skip to main content
Download PDF

Detection of Human cytomegalovirus UL55 Gene and IE/E Protein Expression in Colorectal Cancer Patients in Egypt

BMC Cancer volume 23, Article number: 723 (2023) Cite this article

Abstract

Background

A possible relation between Human cytomegalovirus (HCMV) and colorectal cancer (CRC) has been widely explored with an unclear role yet speculated.

Aim

The study aimed at detecting HCMV UL55 gene, immediate early and early (IE/E) proteins in colorectal tumor tissues and adjacent non neoplastic tissues (ANNT). Also, it aimed to correlate HCMV presence with CRC clinicopathological features.

Subjects and methods

A prospective study of 50 HCMV seropositive patients with resectable CRC were enrolled in the study. Demographic, clinical, and radiological findings were recorded. Pathological assessment was done. Paired CRC tumorous and ANNT were examined for HCMV UL55 by PCR and for IE/ E proteins by immunohistochemistry (IHC).

Results

70% of CRC patients enrolled were females and 36% were elderly (> 60y). Adenocarcinoma was the prevalent histopathological type (92%) with Grade 2, higher stages, and nodal involvement accounting for (64%, 64% and 56%) respectively.

HCMV detection was significantly higher in tumoral tissue versus ANNT by PCR and IHC (P < 0.001, P < 0.008) respectively. Moderate agreement was found between the two techniques (κ = 0.572, P < 0.001).

Univariate analysis identified HCMV presence to be significantly higher in elderly patients, in tumors with higher stage and with nodal involvement (P = 0.041, P = 0.008, P = 0.018 respectively). In multivariate analysis, the latter two retained significance (P = 0.010, P = 0.008).

Conclusion

CRC tumor tissues are more infected by HCMV than ANNT. A significant association of HCMV presence with a higher CRC tumor stage and nodal involvement in an age-dependent manner was detected. HCMV oncomodulatory and a disease progression role is suspected.

Peer Review reports

Introduction

Human cytomegalovirus (HCMV) is a ubiquitous virus with population seropositivity reaching up to 100% in Africa and Asia [1]. It attains a lifelong latency in haematopeitic progenitor cells. HCMV causes a wide range of infections ranging from asymptomatic to mild infections and occasionally severe infections in the immunocompromised as well as teratogenicity during pregnancy [2]. Correlation between HCMV and different human cancers has been widely explored with mixed results between studies [3].

HCMV encodes a wide range of proteins which have major oncomodulatory effect on changing cell survival behavior and alteration of immune surveillance [4]. HCMV US28 gene is implicated in the HCMV-generated angiogenic phenotype by secreting vascular endothelial growth factor (VEGF), a key molecular for angiogenesis [5, 6]. HCMV encodes Immediate early (IE) proteins including UL37 exon 1, UL36, and UL38 proteins that interfere with antiapoptotic genes e.g. retinoblastoma, p53 and cyclins as well as induction proapoptotic genes e.g. fos and myc [7]. Also, the level of Cyclooxygenase 2 (COX-2) increases in viral infected cells. COX-2 is a main source of prostaglandins which promotes inflammatory conditions [8]. Moreover, HCMV infection changes the formulation of matrix metalloproteinases, that enhance tumor growth by destroying matrix barriers and increasing angiogenesis, thus are crucial in cancer metastasis. Chromosomal aberration and instability are also described [9, 10]. Moreover, HCMV impacts the anticancer immunity. It enables tumors to evade immune surveillance by encoding viral proteins as US28, UL111A, and UL144 resulting in HCMV-induced immunological tolerance, which promotes tumor growth [11, 12]. Additionally, HCMV has been recently categorized into low risk (LR) strains causing oncomodulation and high risk (HR) strains with direct oncogenic potential. The molecular mechanisms behind HCMV-induced oncogenesis are complex, with cellular stress, PGCCs (Polypoid giant cancer cells), and genomic instability all playing a role [11].

HCMV can infect any part of the gastrointestinal tract from the mouth till the rectum with a spectrum of illnesses. Colorectal cancer (CRC), a multifactorial disease with infectious agents incriminated, is a leading cause of cancer with high morbidity and mortality worldwide [13].

Molecular based methods are the most widely used diagnostic tests for detection of HCMV infection as well as detecting reactivation [14]. Immunohistochemistry (IHC) for demonstration of HCMV proteins in tissue specimens is not routinely done but can give important topographical information about the viral location inside the cell [15].

The study aimed at detecting HCMV UL55 gene, immediate early and early (IE, E) proteins in colorectal tumor tissues and the adjacent non neoplastic tissues (ANNT). Also, it aimed to correlate HCMV presence with clinical and pathological features of the disease. To our best knowledge, this is the first study exploring HCMV and CRC relationship in Egypt.

Patients and methods

Study setting and exclusion criteria

A prospective study of 50 HCMV seropositive patients with resectable CRC admitted to the General Surgery department for tumor resection from December 2020 to May 2022 was carried out.

Patients aged younger than 20 years or pregnant, had otherwise immunocompromising conditions, patients who received previous neoadjuvant chemotherapy, or with metastasis were excluded.

Data collection and Clinical assessment

Demographic data, medical, drug, surgical, family history as well as patients’ complaints and clinical signs were recorded.

Preoperative investigations were done including

  1. A.

    Laboratory tests (Complete blood picture, and carcinoembryonic antigen (CEA)) [16]

  2. B.

    Radiological investigations (MSCT Enterocolonography scan to access resectability)

  3. C.

    Colonoscopy and biopsy pathology report [17]

Surgically resected CRC specimens were subjected to: Routine pathological processing [17]

The specimens were fixed in 10% buffered formalin and grossed the following day, with representative sections from the tumor, surgical margins, and pericolic lymph nodes being taken for proper histopathological assessment, grading and staging.

Conventional PCR for detection of HCMV DNA [18, 19]

Fifty paired CRC tumor specimens and their ANNT (> 5 cm apart) were examined for the presence of HCMV DNA by PCR. Excessive formalinization and paraffin embedding were avoided to preserve the integrity of genetic material. Paired tissues were stored at -80ºc.

DNA extraction

DNA was extracted from 25 mg of tissue using QIAamp® DNA FFPE tissue according to manufacturer 's instructions (DNA Mini Kit, Qiagen, CA, USA). The quantity of DNA was confirmed by NanoDrop spectrophotometer. Two primers for amplification of HCMV UL55, encoding a highly conserved gB transmembrane protein, were selected:

5' GCGGTGGTTGCCCAACAGGA 3' and 3' ACGACCCGTGGTCATCTTTA 5' [14]

Conventional PCR reaction was done using Thermoscientific DreamTaq Green PCR Master Mix according to manufacturer's instructions. Briefly, A 25 μl total reaction volume comprising 12.5 μl DreemTaq Green PCR Master Mix, 1 μl downstream primer (10 pmol), 1 μl upstream primer (10 pmol), 1 μl DNA and 9.5 μl H2O was used. The following amplification conditions were followed in an orderly manner based on primer blasting: Activation at 95 °C for 3 min then a total of 40 cycles were done, denaturation at 95 °C for 30 s, annealing at 55 °C for 30 s, then extension at 72 °C for 60 s. A final extension step at 72 °C for 10 min was done.

Gel electrophoresis

The amplification products were analyzed by 2% agarose gels followed by visualization using an ultraviolet trans-illuminator. The presence of a band of 94 base pairs (bp), compared to a reference sizing ladder of known fragment length, was considered positive for HCMV DNA [14].

Immunohistochemistry [15]

Immunohistochemical staining on formalin-fixed, paraffin-embedded (FFPE) sections was carried out according to manufacturer’s instructions using the following monoclonal antibodies: anti-CMV (clones CCH2 and DDG9, dilution 1:200, (DAKO, Carpinteria, CA, USA), which contains two antibodies that react specifically with a 76 kDa HCMV early protein and an immediate early DNA binding protein p52.

Specimen preparation

The antibody was used for labeling FFPE tissue sections. Tissue specimens were cut into sections of approximately 4 µm. Pre-treatment with heat-induced epitope retrieval (HIER) was required using Dako PT Link (Code PT100/PT101). Optimal results were obtained by pretreating tissues using EnVision FLEX Target Retrieval Solution, High pH (50x) (Code K8000/K8004).

Immunoreactions were developed using the EnVision FLEX, High pH, (Link) (Code K8000), using a biotinylated secondary antibody. DAB (Thermo Scientific CAT# 34,065) was used as a chromogenic dye and the tissue was counterstained with Mayer’s Hematoxylin.

Specimens were considered positive if they showed positive staining within the epithelial cells, and negative if they failed to show positive staining within the epithelial cells. Correlation with the viral cytopathic effects was an indispensable confirmatory tool utilized in most cases.

Statistical analysis [20]

Data was fed to the computer and analyzed using IBM SPSS software package version 20.0. (Armonk, NY: IBM Corp). Numerical data were represented as n (%). Chi-square test with Fisher’s Exact or Monte Carlo correction were used to compare different groups with categorical variables. Cohen's Kappa coefficient was used to assess the agreement between PCR and IHC. Univariate values of P < 0.05 were followed by multivariate analysis. The significance of the obtained results was judged at the 5% level.

Results

Patients’ characteristics, clinical and laboratory findings

Among the 50 resectable CRC studied patients, 35 (70%) were females and 18 patients (36%) were elderly (> 60 y). Most patients presented with abdominal pain followed by weight loss and diarrhea (74%,72% and 70% respectively). Intestinal obstruction was present in 10 patients (20%). Most patients had more than one symptom. Family history of colorectal cancer, or previous intestinal history of polyps were recorded in 6 patients (12%). Anaemia was detected in 36 patients (72%) and serum CEA was elevated in 12 (24%).

Pathological assessment of resected colorectal cancer

More than half of the cases (52%) had sigmoid cancer. Adenocarcinoma was the predominant histopathological type (92%) and 62% of tumors were larger than 5 cm in maximum dimension. Moderately differentiated, grade 2 tumors, higher stages (pT3 + pT4) and nodal involvement accounted for 64%, 64% and 56% respectively among different tumoral grades and stages. None of the tumors exhibited distant metastasis.

HCMV DNA detection by PCR

Among the 50 tumorous specimens, HCMV UL55 gene was detected in 32 (64%) samples, while only 13 (26%) samples of ANNT showed a positive result. A statistically significant difference was detected between the two groups (P < 0.001) (Table 1, Fig. 1). Tissues extracted DNA purity, concentration and PCR results are shown in Table S1.

Table 1 Comparison between Tumorous and Adjacent non- neoplastic tissue regarding the detection of Human cytomegalovirus DNA by Polymerase Chain Reaction
Full size table
Fig. 1
figure 1

PCR analysis for HCMV UL55 gene detection (94-bp) on 2% agarose gel. Lane 7: 50 bp DNA ladder, Lane 8: positive control, Lanes 1–6: TTs showing positive PCR results, Lanes 9–12: ANNTs showing positive PCR results, Lanes 13–15: TTs showing negative results. PCR: Polymerase chain reaction, HCMV: Human cytomegalovirus, bp: base pairs TTs: Tumor tissues, ANNTs: Adjacent non neoplastic tissues

Full size image

Immunohistochemical staining

IHC was carried out on 50 paired FFPE sections. Among the 50 tumorous specimens, IHC was positive in 14 samples (28%), negative in 15 (30%) while 21 (42%) samples could not be assessed due to increased N/C ratio. Ten (20%) samples of ANNT demonstrated a positive result while 40 (80%) were negative. IHC results was significantly different between the two groups (P < 0.008) (Table 2 and Fig. 2A-D).

Table 2 Comparison between Tumorous and Adjacent non- neoplastic tissue (n = 50) regarding detection of Human cytomegalovirus Immediate Early and Early proteins by Immunohistochemistry
Full size table
Fig. 2
figure 2

Photomicrography of A IHC staining of adenocarcinoma with negative result, B IHC staining of adenocarcinoma with positive result, C IHC staining of adenocarcinoma with no assessment due to increased N/C ratio, D IHC staining of ANNT with positive result

Full size image

Concordance between Polymerase Chain Reaction and Immunohistochemistry results

Correlation between PCR results and IHC was evaluated in clearly assessed tumorous (n = 29) and ANNT (n = 50). Matched positive results by PCR and IHC was detected in 21 specimens (14 tumor tissue and 7 ANNT) and matched negative results was detected in 42 specimens (8 tumor tissue and 34 ANNT). IHC showed negative results in 13 PCR positive specimens (7 tumor tissue and 6 ANNT). Conversely, only three ANNT specimens were positive by IHC whilst being negative by PCR. Moderate agreement between PCR and IHC in detecting HCMV was detected (Kappa coefficient = 0.572, P < 0.001) (Table 3).

Table 3 Human cytomegalovirus detection in Tumorous and Adjacent non-neoplastic specimens from colorectal cancer patients
Full size table

Correlation between demographic and clinicopathological data versus HCMV DNA results

Different demographic and clinicopathological parameters of the studied patients were correlated to HCMV DNA detection. A significantly statistical difference was detected in patients aged > 60 years, higher CRC stages (T3 and T4) and tumors with nodal involvement (P = 0.033, P = 0.006, P = 0.015) respectively (Table 4).

Table 4 Demographic characteristics and clinicopathological parameters of studied CRC patients in relation to detection of Human cytomegalovirus DNA by PCR
Full size table

Univariate and Multivariate binary logistic regression for parameters correlated with HCMV DNA presence in tumoral tissue of the studied patients

Univariate analysis detected significant HCMV DNA presence in elderly patients, CRC with higher stages and nodal involvement.

(OR:4.412, 95% CI:1.066 – 18.266, P = 0.041), (OR:5.612, 95% CI:1.584 –19.886, P = 0.008), (OR:4.400, 95% CI:1.283 – 15.091, P = 0.018) respectively.

in the multivariate analysis, significant HCMV DNA detection was retained in CRC with higher stages and nodal involvement (OR:9.462, 95% CI:1.709 – 52.375, P = 0.010) (OR:10.046, 95% CI: 1.808 – 55.838, P = 0.008) respectively Table 5.

Table 5 Univariate and Multivariate binary logistic regression for parameters correlated with HCMV DNA presence in tumoral tissue of the studied patients
Full size table

Discussion

The relation between HCMV and CRC pathogenesis is of a high research interest and being increasingly explored aiming to unravel the precise viral role. The aim of the current study was to detect HCMV by PCR and IHC in colorectal cancer samples as well as to correlate HCMV presence to different CRC demographic, clinical and pathological parameters.

Overall, Colorectal cancer is the second leading cause of cancer mortality and third in incidence. The incidence of CRC is rising in low-medium income countries (LMIC) due to changes in lifestyle [21]. HCMV is highly ubiquitous reaching almost 100% seroprevalence in adults in developing countries with a lifelong latency [1, 22]. In the current study, HCMV presence was assessed in paired tumorous and ANNT tissues of 50 seropositive CRC patients by two techniques; PCR and IHC. UL55 gene primer, encoding highly conserved HCMV gB, was chosen according to a HCMV primer comparative study which reported PCR sensitivity to be inversely proportional to the length of the PCR product i.e. sensitivity being higher when the product is less than 100 bp [14]. DNA was extracted from tissues with minimal formalinization and before fixation to preserve DNA integrity [19]. A significantly higher detection rate was observed in PCR results in tumorous tissues versus ANNT group (64% vs 26%, P < 0.001). Two metaanalyses, one investigating HCMV presence in gastrointestinal cancers and the other focusing on CRC, significantly detected HCMV in tumoral tissues [23, 24]. On the other hand, recently Chelbi et al. showed no difference of UL55 gene detection in tumor versus peritumor tissues [25]. Also, earlier studies found no relation between HCMV and CRC [26,27,28]. This might be due to the small number of included cancerous samples, non-optimization of PCR technique, or due to testing FFPE as tumor specimens which was avoided in this study. HCMV infection at certain stages of tumor development followed by its clearance is also a possible cause.

IHC is a valuable technique to detect viral protein expression and thus differentiate latent from active infection as well as demonstrate the specific site inside the cell. HCMV IE/E proteins are transactivators for expression of early and late viral genes. They are essential to establish lytic infection and viral re-activation dysregulating cellular functions [5, 29].

In the present study, a significantly higher detection of HCMV IE and E proteins was observed in tumorous tissues versus ANNT group (P < 0.008). Taher et al. reported in 2 studies higher prevalence of HCMV IE DNA and protein expression in CRC and breast cancer and their metastases to the brain with poor outcome [30, 31]. Recently, two studies reported that HCMV gB DNA detection or expression of HCMV IE in breast cancer was found to be associated with shorter survival [32, 33]. HCMV IE and E proteins were always detected in the cytoplasm in this study. Chen et al. and Dimberg et al. also demonstrated that viral antigens are preferentially detected in the tumor cytoplasm [34, 35]. Two possible explanations were hypothesized for HCMV viral protein expression in tumoral tissue, either HCMV is carried to the tumor and become reactivated due to suppressed immunity or, more likely, the inflammatory process reactivates the already existing virus [18].

In the present work, a lower HCMV detection rate was obtained by IHC than PCR which could be due to expression of a mutated protein, [36] or due to masking viral proteins by increased N/C ratio in malignant cells which at many times reached a ratio of 1:1.

When comparing PCR and IHC results, a moderate agreement was detected (Kappa coefficient = 0.572, P < 0.001). One study comparing PCR and IHC to explore the relation between HCMV and breast cancer showed a fair concordance (kappa = 0.345; P = 0.003) [37]. In fact, combination of PCR and IHC to explore HCMV role in CRC in Egyptian population and reporting the significant association between HCMV presence and CRC as well as detection of the moderate agreement between the two techniques is distinctive in the current study. Only a few earlier studies combined IHC to PCR for HCMV detection and found no relation to CRC. Interestingly, the fact that immunostaining was detected in the cytoplasm and not in the nucleus, as in cases of acute infection, was their reason to consider it as nonspecific staining [26, 28]. Nevertheless, “the hit and run” theory of oncogenesis could not be ruled out. On the contrary, a pioneer study by Harkins et al. detected a significant relationship and postulated an oncogenic rule [38]. A recent study of the effect of IE viral protein on CRC derived stem cell discovered cytoplasmic localization to be the most commonly detected [39].

In the present study, 70% of the enrolled CRC patients were females and 36% were elderly (> 60y). A recent meta-analysis reported higher incidence of CRC in males, and in elderly patients [40]. Adenocarcinoma was the prevalent histopathological type (92%) with Grade 2, higher stages (T3 + T4) and nodal involvement accounting for (64%, 64% and 56%) respectively. Our findings could be attributed to scarcity of screening programs so that the disease is only discovered after seeking medical advice on complaining.

When demographic and clinicopathological parameters were correlated to HCMV DNA presence, a statistically significant relationship in patients aged > 60 years, with higher CRC stages and tumors with nodal involvement (P = 0.033, P = 0.006, P = 0.015) respectively.

In multivariate analysis, significant HCMV DNA detection was retained in CRC higher stages (T3 + T4) and nodal involvement (P = 0.010, P = 0.008). Thus, the most independent factor affecting HCMV detection was nodal involvement followed by stages 3 and 4 in colorectal cancer. This study’s results thus suspect a HCMV role in disease progression even in the absence of a clear role.

In a study of CRC progression in the elderly, Chen et al. demonstrated poorer outcome in the presence of HCMV independent of other factors and reported no correlation with demographic, clinical or pathological factors as grading, local extension and nodal involvement to HCMV presence. They suggested that decreased immunity with age may be an important risk factor to HCMV reactivation, nevertheless, a causal relation could not be confirmed [36]. In another study for the non-elderly, Chen et al. found an opposite effect suggesting a dual oncomodulatory age-dependent effect for HCMV presence [41]. This may be due to stimulation of the immune response to HCMV infection in young age [42].

Interplay between oncomodulatory/oncogenesis role of HCMV was suggested in the context of identification of high risk HCMV strains versus low risk strains showing difference in disease progression, survival rate and response to treatment [5, 43]. Surprisingly, on the other hand, a recent clinical analysis study detected a statistically significant correlation between HCMV infection and lower CRC incidence [44]. The detection of HCMV DNA as well as active transcription of IE protein in CRC tumor tissues points to a substantial oncomodulatory profile in the elderly.

Conclusion

CRC tumor tissues are more infected by HCMV than ANNT. A significant association of HCMV presence with a higher CRC tumor stage and nodal involvement in an age-dependent manner was detected. HCMV oncomodulatory and a disease progression role is suspected.

Limitations and recommendations of the study

A larger follow up study with stratification according to demographic and clinicopathological parameters is needed. Alleged viral proteins responsible for oncogenesis should be studied. Treatment regimens including HCMV antivirals will be very valuable to assess the intensity of HCMV role. The study findings combined with other multicenter studies would help expert panel to develop guidelines regarding HCMV prophylaxis and/or add on antiviral therapy that can improve survival rate.

Availability of data and materials

Available upon reasonable request from the corresponding author.

References

  1. Mana H Al, Yassine HM, Younes NN, Al-Mohannadi A, Al-Sadeq DW, Alhababi D, et al. The current status of cytomegalovirus (CMV) prevalence in the MENA region: a systematic review. Pathogens. 2019;8. https://doi.org/10.3390/pathogens8040213.

  2. Fakhreddine AY, Frenette CT, Konijeti GG. A practical review of cytomegalovirus in gastroenterology and hepatology. Gastroenterol Res Pract. Hindawi; 2019. https://doi.org/10.1155/2019/6156581.

  3. Nauclér CS, Geisler J, Vetvik K. The emerging role of human cytomegalovirus infection in human carcinogenesis : a review of current evidence and potential therapeutic implications. Oncotarget. 2019;10:4333–47.

    Article  PubMed  PubMed Central  Google Scholar 

  4. Ye L, Qian Y, Yu W, Guo G, Wang H, Xue X. Functional profile of human cytomegalovirus genes and their associated diseases: a review. Front Microbiol. 2020:1–13. https://doi.org/10.3389/fmicb.2020.02104.

  5. Geisler J, Touma J, Rahbar A, Söderberg-Nauclér C, Vetvik K. A review of the potential role of human cytomegalovirus (HCMV) infections in breast cancer carcinogenesis and abnormal immunity. Cancers (Basel). 2019;11:1842.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  6. Cai ZZ, Xu JG, Zhou YH, Zheng JH, Lin KZ, Zheng SZ, et al. Human cytomegalovirus-encoded US28 may act as a tumor promoter in colorectal cancer. World J Gastroenterol. 2016;22:2789–98.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  7. El Baba R, Herbein G. Immune Landscape of CMV Infection in Cancer Patients: From “Canonical” Diseases Toward Virus-Elicited Oncomodulation. Front Immunol. 2021;12:1–17.

    Google Scholar 

  8. Andouard D, Gueye R, Hantz S, Fagnère C, Liagre B, Bernardaud L, et al. Impact of new cyclooxygenase 2 inhibitors on human cytomegalovirus replication in vitro. Antivir Ther. 2021;26:117–25.

    Article  CAS  PubMed  Google Scholar 

  9. Moussawi FA, Kumar A, Pasquereau S, Tripathy MK, Karam W, Diab-Assaf M, et al. The transcriptome of human mammary epithelial cells infected with the HCMV-DB strain displays oncogenic traits. Sci Rep. 2018;8:1–14.

    Article  Google Scholar 

  10. Ball CB, Parida M, Li M, Spector BM, Suarez GA, Meier JL, et al. Human Cytomegalovirus Infection Elicits Global Changes in Host Transcription by RNA Polymerases I, II, and III. Viruses. 2022;14:779.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  11. Herbein G. High-risk oncogenic human cytomegalovirus. Viruses. 2022:1–11. https://doi.org/10.3390/v14112462.

  12. Jackson SE, Redeker A, Arens R, van Baarle D, van den Berg SPH, Benedict CA, et al. CMV immune evasion and manipulation of the immune system with aging. GeroScience. 2017;39:273–91.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  13. Siegel RL, Miller KD, Goding Sauer A, Fedewa SA, Butterly LF, Anderson JC, et al. Colorectal cancer statistics, 2020. CA Cancer J Clin. 2020;70:145–64.

    Article  PubMed  Google Scholar 

  14. Habbal W, Monem F, Gärtner BC. Comparative evaluation of published cytomegalovirus primers for rapid real-time PCR: Which are the most sensitive? J Med Microbiol. 2009;58:878–83.

    Article  CAS  PubMed  Google Scholar 

  15. Mills AM, Guo FP, Copland AP, Pai RK, Pinsky BA. A comparison of cmv detection in gastrointestinal mucosal biopsies using immunohistochemistry and pcr performed on formalin-fixed, paraffin-embedded tissue. Am J Surg Pathol. 2013;37:995–1000.

    Article  PubMed  Google Scholar 

  16. DB., Sacks GL. Tietz textbook of clinical chemistry and molecular diagnostics. 5th ed. In: Burtis CA, Ashwood ER B DE E, editors. Ann Clin Biochem Int J Lab Med. St Louis: Elsevier Saunders Company; 2012. https://doi.org/10.1258/acb.2012.201217.

  17. Kim BH, Kim JM, Kang GH, Chang HJ, Kang DW, Kim JH, et al. Standardized pathology report for colorectal cancer, 2nd edition. J Pathol Transl Med. 2020;54:1–19.

    Article  CAS  PubMed  Google Scholar 

  18. Chen HP, Jiang JK, Lai PY, Teo WH, Yang CY, Chou TY, et al. Serological and viraemic status of human cytomegalovirus infection in patients with colorectal cancer is not correlated with viral replication and transcription in tumours. J Gen Virol. 2016;97:152–9.

    Article  CAS  PubMed  Google Scholar 

  19. Mielonen OI, Pratas D, Hedman K, Sajantila A, Perdomo MF. Detection of Low-Copy Human Virus DNA upon Prolonged Formalin Fixation. Viruses. 2022;14:1–12.

    Article  Google Scholar 

  20. George D, Mallery P. IBM SPSS statistics processes for Mac. IBM SPSS stat 26 step by step. Routledge; 2020. p. 26–42. https://doi.org/10.4324/9780429056765.

  21. Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, et al. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin. 2021;71:209–49.

    Article  PubMed  Google Scholar 

  22. Söderberg-Nauclér C. HCMV microinfections in inflammatory diseases and cancer. J Clin Virol. 2008;41:218–23.

    Article  PubMed  Google Scholar 

  23. Lv YL, Han FF, An ZL, Jia Y, Xuan LL, Gong LL, et al. Cytomegalovirus Infection Is a Risk Factor in Gastrointestinal Cancer: A Cross-Sectional and Meta-Analysis Study. Intervirology. 2020;63(1–6):10–6.

    Article  CAS  PubMed  Google Scholar 

  24. Bai B, Wang X, Chen E, Zhu H. Human cytomegalovirus infection and colorectal cancer risk: A meta-analysis. Oncotarget. 2016;7:76735–42.

    Article  PubMed  PubMed Central  Google Scholar 

  25. Chelbi H, Jelassi R, Belfkih S, Amor AB, Saidi N, Krishna BA. Association of CCR5 Δ 32 deletion and human cytomegalovirus infection with colorectal cancer in tunisia. Front Genet. 2021;12:1–10.

    Article  Google Scholar 

  26. Akintola-Ogunremi O, Luo Q, He TC, Wang HL. Is cytomegalovirus associated with human colorectal tumorigenesis? Am J Clin Pathol. 2005;123:244–9.

    Article  PubMed  Google Scholar 

  27. Bender C, Zipeto D, Bidoia C, Costantini S, Zamo A, Menestrina F, et al. Analysis of colorectal cancers for human cytomegalovirus presence. Infect Agent Cancer. 2009;4:1–6.

    Article  Google Scholar 

  28. Knösel T, Schewe C, Dietel M, Petersen I. Cytomegalovirus is not associated with progression and metastasis of colorectal cancer. Cancer Lett. 2004;211:243–7.

    Article  PubMed  Google Scholar 

  29. Wang YQ, Zhao XY. Human Cytomegalovirus Primary Infection and Reactivation: Insights From Virion-Carried Molecules. Front Microbiol. 2020;11:1511.

    Article  PubMed  PubMed Central  Google Scholar 

  30. Taher C, Frisk G, Fuentes S, Religa P, Costa H, Assinger A, et al. High prevalence of human cytomegalovirus in brain metastases of patients with primary breast and colorectal cancers. Transl Oncol. 2014;7:732–40. Neoplasia Press, Inc

    Article  PubMed  PubMed Central  Google Scholar 

  31. Taher C, de Boniface J, Mohammad AA, Religa P, Hartman J, Yaiw KC, et al. High Prevalence of Human Cytomegalovirus Proteins and Nucleic Acids in Primary Breast Cancer and Metastatic Sentinel Lymph Nodes. PLoS One. 2013;8(2):e56795.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  32. Yang Z, Tang X, Hasing ME, Pang X, Ghosh S, Mcmullen TPW, et al. Human Cytomegalovirus Seropositivity and Viral DNA in Breast Tumors Are Associated with Poor Patient Prognosis. Cancers (Basel). 2022;14:1–23.

    Google Scholar 

  33. Touma J, Pantalone MR, Rahbar A, Liu Y, Vetvik K, Sauer T, et al. Human Cytomegalovirus Protein Expression Is Correlated with Shorter Overall Survival in Breast Cancer Patients: A Cohort Study. Viruses. 2023;15:732.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  34. Chen HP, Jiang JK, Chen CY, Chou TY, Chen YC, Chang YT, et al. Human cytomegalovirus preferentially infects the neoplastic epithelium of colorectal cancer: A quantitative and histological analysis. J Clin Virol. 2012;54:240–4. Elsevier B.V

    Article  PubMed  Google Scholar 

  35. Dimberg J, Trinh Hong T, Skarstedt M, Löfgren S, Zar N, Matussek A. Detection of cytomegalovirus DNA in colorectal tissue from Swedish and Vietnamese patients with colorectal cancer. Anticancer Res. 2013;33:4947–50.

    CAS  PubMed  Google Scholar 

  36. Chen HP, Jiang JK, Lai PY, Chen CY, Chou TY, Chen YC, et al. Tumoral presence of human cytomegalovirus is associated with shorter disease-free survival in elderly patients with colorectal cancer and higher levels of intratumoral interleukin-17. Clin Microbiol Infect. 2014;20:664–71.

    Article  CAS  PubMed  Google Scholar 

  37. El Shazly DF, Bahnassey AA, Omar OS, Elsayed ET, Al-Hindawi A, El-Desouky E, et al. Detection of Human Cytomegalovirus in Malignant and Benign Breast Tumors in Egyptian Women. Clin Breast Cancer. 2018;18:e629-42. Elsevier Inc

    Article  PubMed  Google Scholar 

  38. Harkins L, Volk AL, Samanta M, Mikolaenko I, Britt WJ, Bland KI, et al. Specific localisation of human cytomegalovirus nucleic acids and proteins in human colorectal cancer. Lancet. 2002;360:1557–63. Elsevier B.V

    Article  CAS  PubMed  Google Scholar 

  39. Teo WH, Chen HP, Huang JC, Chan YJ. Human cytomegalovirus infection enhances cell proliferation, migration and upregulation of EMT markers in colorectal cancer-derived stem cell-like cells. Int J Oncol. 2017;51:1415–26.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  40. Wong MCS, Huang J, Huang JLW, Pang TWY, Choi P, Wang J, et al. Global Prevalence of Colorectal Neoplasia: A Systematic Review and Meta-Analysis. Clin Gastroenterol Hepatol. 2020;18:553-561.e10 Elsevier, Inc.

    Article  PubMed  Google Scholar 

  41. Chen HP, Jiang JK, Chen CY, Yang CY, Chen YC, Lin CH, et al. Identification of human cytomegalovirus in tumour tissues of colorectal cancer and its association with the outcome of non-elderly patients. J Gen Virol. 2016;97:2411–20.

    Article  CAS  PubMed  Google Scholar 

  42. Pera A, Campos C, Corona A, Sanchez-Correa B, Tarazona R, Larbi A, et al. CMV latent infection improves CD8+ T response to SEB due to expansion of polyfunctional CD57+ cells in young individuals. PLoS ONE. 2014;9:1–7.

    Article  Google Scholar 

  43. Herbein G. Tumors and cytomegalovirus: an intimate interplay. Viruses. 2022. https://doi.org/10.3390/v14040812.

    Article  PubMed  PubMed Central  Google Scholar 

  44. Nagel B, Frankel L, Ardeljan A, Cardeiro M, Rashid S, Takabe K, et al. The Association of Human Cytomegalovirus Infection and Colorectal Cancer: A Clinical Analysis. World J Oncol. 2023;14:119–24.

    Article  PubMed  PubMed Central  Google Scholar 

Download references

Acknowledgements

The authors are thankful for the patients who agreed to participate in the study. Also, the authors are grateful for the molecular and pathology diagnostic laboratories staff for their sincere cooperation and help.

Funding

Open access funding provided by The Science, Technology & Innovation Funding Authority (STDF) in cooperation with The Egyptian Knowledge Bank (EKB). The authors declare that no funds, grants, or other support were received during this study or preparation of the manuscript.

Author information

Authors and Affiliations

  1. Medical Microbiology and Immunology Department, Faculty of Medicine, Alexandria University, 0 Khartoum Square, Azarita Medical Campus, Alexandria, 21131, Egypt

    May Raouf, Mahinour A. Ragab & Amira Amer

  2. General Surgery Department, Faculty of Medicine, Alexandria University, Alexandria, Egypt

    Ahmed A. Sabry

  3. Pathology Department, Faculty of Medicine, Alexandria University, Alexandria, Egypt

    Samar El Achy

Authors
  1. May Raouf
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Ahmed A. Sabry
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Mahinour A. Ragab
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Samar El Achy
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Amira Amer
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

A.A. developed the idea of the research. A.A., M.R., A.S., S.A. designed the protocol. A.S. selected eligible patients. S.A. managed IHC. M.A.R. collected data, performed molecular and primary statistics. A.A. and M.R. revised data and analysis. M.R. wrote draft. A.A. revised draft. All authors approved the final manuscript.

Corresponding author

Correspondence to May Raouf.

Ethics declarations

Ethics approval and consent to participate

The study was approved by the Ethical Committee, Faculty of Medicine, Alexandria University (IRB number 00012098, FWA number 00018699) on 18/06/2020 (EC Serial Protocol Number = 0106396). Research has been conducted in accordance with the Declaration of Helsinki. Informed consent was obtained from all subjects enrolled in this study.

Consent for publication

Not applicable.

Competing interests

The authors have no financial or non-financial interests to disclose.

Additional information

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

Additional file 1:

 Table S1. Tissues extracted DNA purity, concentration and PCR results.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Raouf, M., Sabry, A.A., Ragab, M.A. et al. Detection of Human cytomegalovirus UL55 Gene and IE/E Protein Expression in Colorectal Cancer Patients in Egypt. BMC Cancer 23, 723 (2023). https://doi.org/10.1186/s12885-023-11200-x

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s12885-023-11200-x

Keywords

BMC Cancer

ISSN: 1471-2407

Contact us