Skip to main content
Download PDF

CDC6, a key replication licensing factor, is overexpressed and confers poor prognosis in diffuse large B-cell lymphoma

BMC Cancer volume 23, Article number: 978 (2023) Cite this article

Abstract

Background

Cell division cycle 6 (CDC6) is a key licensing factor in the assembly of pre-replicative complexes at origins of replication. The role of CDC6 in the pathogenesis of in diffuse larger B-cell lymphoma (DLBCL) remains unknown. We aim to investigate the effects of CDC6 on the proliferation, apoptosis and cell cycle regulation in DLBCL cells, delineate its underlying mechanism, and to correlate CDC6 expression with clinical characteristics and prognosis of patients with DLBCL.

Methods

Initial bioinformatic analysis was performed to screen the potential role of CDC6 in DLBCL. Lentiviral constructs harboring CDC6 or shCDC6 was transfected to overexpress or knockdown CDC6 in SUDHL4 and OCI-LY7 cells. The cell proliferation was evaluated by CCK-8 assay, cell apoptosis was detected by Annexin-V APC/7-AAD double staining, and cell cycle was measured by flow cytometry. Real time quantitative PCR and western blot was used to characterize CDC6 expression and its downstream signaling pathways. The clinical data of DLBCL patients were retrospectively reviewed, the CDC6 expression in DLBCL or lymph node reactive hyperplasia tissues was evaluated by immunohistochemistry.

Results

In silico data suggest that CDC6 overexpression is associated with inferior prognosis of DLBCL. We found that CDC6 overexpression increased SUDHL4 or OCI-LY7 cell proliferation, while knockdown of CDC6 inhibited cell proliferation in a time-dependent manner. Upon overexpression, CDC6 reduced cells in G1 phase and did not affect cell apoptosis; CDC6 knockdown led to significant cell cycle arrest in G1 phase and increase in cell apoptosis. Western blot showed that CDC6 inhibited the expression of INK4, E-Cadherin and ATR, accompanied by increased Bcl-2 and deceased Bax expression. The CDC6 protein was overexpressed DLBCL compared with lymph node reactive hyperplasia, and CDC6 overexpression was associated with non-GCB subtype, and conferred poor PFS and OS in patients with DLBCL.

Conclusion

CDC6 promotes cell proliferation and survival of DLBCL cells through regulation of G1/S cell cycle checkpoint and apoptosis. CDC6 is overexpressed and serves as a novel prognostic marker in DLBCL.

Peer Review reports

Introduction

Diffuse large B-cell lymphoma (DLBCL) is one of the most frequent lymphomas that accounts for 30–40% of non-Hodgkin lymphomas [1, 2]. With a frontline R-CHOP (rituximab, cyclophosphamide, doxorubicin, vincristine and prednisone) immunochemotherapy, the 5-year overall survival (OS) rate for DLBCL has increased to more than 60%, but 40–45% of DLBCL are still refractory or relapsed with poor prognosis [1, 2]. Risk stratification of DLBCL is mainly dependent on calculation of the International Prognostic Index (IPI), revised IPI or national comprehensive cancer network (NCCN)-IPI, primarily based on known clinical risk factors [3]. In addition, cell-of-origin (COO) defined by immunohistochemical (IHC) algorithms, are used as surrogates for gene expression profiling (GEP) to assign DLBCL as germinal center B-cell (GCB) or non-GCB subtype [4]. Generally, GCB DLBCL is associated with an improved outcome compared to non-GCB DLBCL in patients receiving the upfront standard of care [4]. Identification of novel biomarker may help to refine risk assessment, inform treatment decision-making and predict treatment response and clinical outcome.

DNA replication is an essential cellular process, in which cell division cycle 6 (CDC6) functions as a key licensing factor responsible for the assembly of pre-replicative complexes at origins of replication during the G1 phase of the cell cycle (Supplemental Fig. 1) [5, 6]. Previous studies have shown that CDC6 is a bona fide proto-oncogene that involves in tumor initiation and progression, and it is often over-expressed in many tumor types, providing the rationales for CDC6 as a novel therapeutic target [7, 8]. However, the clinical significance and mechanisms of action of CDC6 in lymphoma are poorly understood.

In this study, we investigated the role of CDC6 in the development of DLBCL, and explored the underlying mechanisms by which CDC6 regulates cell proliferation and apoptosis. To define the prognostic role in DLBCL, we retrospectively analyzed the clinical data of DLBCL patients, detected CDC6 expression by immunohistochemistry, and correlated CDC6 expression with clinicopathological features and prognosis of patients with DLBCL.

Materials and methods

Bioinformatic analysis

We used two series of DLBCL from 2 different databases: (1) The transcriptomic data of 47 DLBCL patients and 337 normal donors were obtained from The Cancer Genome Atlas (TCGA; https://cancergenome.nih.gov/) database and the Genotype-Tissue Expression (GTEX; https://gtexportal.org), respectively; (2) The CDC6 transcriptional expression and relevant survival information obtained from the Gene Expression Omnibus (GEO) (https://www.ncbi.nlm.nih.gov/geo/, accession number: GSE10846).

Patients

Between January 2012 and December 2018, 60 patients with DLBCL were enrolled in the First Hospital of Jiaxing, Zhejiang, China. The pathological diagnosis was established or re-confirmed according to the 2016 WHO classification criteria for lymphohematopoietic tissues. Most patients were treated with the modified R-CHOP/CHOP 21 regimens (rituximab, cyclophosphamide, epirubicin or liposomal doxorubicin, vindesine, dexamethasone or prednisone), and a few elderly patients received reduced-dose R-CHOP or R-COP chemotherapy; for those did not achieve CR, the second-line regimens, such as GDP (gemcitabine, cisplatin, dexamethasone) and ICE (ifosfamide, carboplatin, etoposide, epirubicin), were given. In addition, 20 patients with reactive hyperplasia of lymph nodes were included the control group. The study was performed in accordance with the Declaration of Helsinki, and was approved by the institutional review board of the First Hospital of Jiaxing.

Plasmids

To generate a construct overexpressing CDC6, cDNA fragment was amplified by the sense primer 5 ‘-TAGAGCTAGCGAATTCATGCCTCAAACCCGATCCC-3’ and the antisense primer 5 ‘-CTTTGTAGTCGGATCCAGGCAATCCAGTAGCTAAGAT-3’, and cloned into pLenO-GTP-c-3flag vector, the resulting construct was designated as pLenO-CDC6. To generate construct expressing shRNA targeting CDC6, oligos were annealed and cloned into pLenR-GPH vector, the resulting construct was designated as pLenR-shCDC6. With the shRNA targeting region shown in bold, the oligos were sense 5 ‘-GATCCCGGGCATTGAACAAAGCTAAACTTCCTGTCAGATTTAGCTTTGTTCAATGCCCGTTTTTG-3’ and antisense 5 ‘- AATTCAAAAACGGGCATTGAACAAAGCTAAATCTGACAGGAAGTTTAGCTTTGTTCAATGCCCGG-3’.

Cell culture and transfection

Human B-cell lymphoma cell line SUDHL4 was purchased from Cobioer Bioscience (Nanjing, China), OCI-LY7 was from Keygen Biotech (Nanjing, China). Both cell lines were cultured in RPMI-1640 with 10% FBS and antibiotics. To over-express or knockdown CDC6, SUDHL4 or OCI-LY7 was infected with lentivirus packaging with indicated plasmids, including pLenO vetor, pLenO-CDC6, pLenR-GPH vector and pLenR-GPH-shCDC6, respectively.

Real time quantitative PCR

Total RNA was isolated by using Trizol reagents (Invitrogen) and reverse transcribed into cDNA. Quantitative real-time PCR was performed in triplicate, using One Step TB Green PrimeScript RT-PCR Kit II (SYBR Green) (TaKaRa, Japan) following the manufacturer’s instructions. The relative level of CDC6 mRNA was calculated using the method of 2-ΔΔCt and normalized to human GAPDH gene. The primers for CDC6 included the upstream 5 ‘- GCAGTTCAATTCTGTGCCCG − 3’ and the downstream 5-ATAGCTCCTGCAAACATCCA-3 ‘; for GAPDH, the upstream primer was 5 ‘-AGATCATCAGCAATGCCTCCT-3’ and the downstream primer was 5 ‘-TGAGTCCTTCCACGATACCAA − 3’.

Cell proliferation, apoptosis assays and cell cycle analysis

Cell proliferation was determined by using CCK-8 assay. SUDHL4 or OCI-LY7 cells were seeded at a density of 5 × 103 per well in 96-well plates and 10 µl of CCK-8 reagent was added and incubated at 37 ° C for 3 h. The absorbance (OD) at 450 nm was measured. Cell apoptosis was determined by annexin V-APC/7-AAD apoptosis detection kit (Keygen Biotech, China), Briefly, after transfection for 24 h, 48 and 72 h, cells were collected, stained with annexin V-APC and 7-AAD according to the manufacturer’s instructions, and then analyzed by flow cytometry. Each experiment was done in triplicate. For DNA histogram analysis, cells were stained with propidium iodide, and analyzed by flow cytometry.

Immunofluorescence

The transfected cells grown on chamber slides were fixed with 4% paraformaldehyde in phosphate-buffered saline (PBS) for 30 min at room temperature or overnight at 4℃, treated with 3% H2O2-methanol solution for 10 min, and washed with PBS. After blocking with goat serum for 20 min, cells were incubated with primary antibody against CDC6 (ab109315, abcam, UK) at 37℃ for 2 h, and then incubated with TRITC-conjugated secondary antibody (diluted 1:100) at 37℃ for 1 h. After washing, cell nuclei were stained with 4,6-diamidino-2-phenylindole (DAPI) for 5 min, and fluorescence was visualized using a confocal laser scanning microscope.

Western blot

After 72-h transfection, cells were collected, washed twice with pre-cooled PBS, and lysed on ice with buffer containing 10 µl phosphatase inhibitor, 1 µl protease inhibitor, and 5 µl 100 mM PMSE for 30 min. The resulting cell lysate was centrifuged at 14,000 rpm for 15 min at 4℃, and the supernatant was aspirated for protein quantification by the Bradford method. Proteins were separated by SDS-PAGE electrophoresis, electro-transferred to a polyvinylidene fluoride (PVDF) membrane. After blocking at room temperature for 2 h, membrane was incubated with primary antibody overnight at 4℃, and then probed with secondary antibody at room temperature for 1–2 h. The blot was visualized by G: BOX chemiXR5 imaging and analyzed by Gel-Pro32 software. The primary antibodies against CDC6 (ab109315), caspase-3 (ab197202), bcl-2 (ab182858), Bax (ab182734), E-cadherin (ab40772), and ATR (ab13798) were purchased from abcam, UK; anti-INK4 (Cst 74,560) was from Cell Signaling Technology, US.

Immunohistochemistry (IHC)

Specimens were fixed in 10% neutral buffered formalin solution, embedded in paraffin, serially sectioned at 4 μm, and then stained with CDC6 monoclonal antibody (ab109315) or antibodies such as anti-CD20, CD79a, CD3, CD5, CD10, BCL-6, MUM1, BCL-2, Ki-67, CyclinD1 by the EnVision Detection System K5007 (Dako, Denmark) according to the manufacturer’s instructions. Phosphate buffered saline (PBS) was used as a negative control. All specimens were reviewed and confirmed independently by two pathologists. Breast cancer tissue was used as CDC6 positive control. To quantity CDC6 expression, five high-power fields (x200) were randomly selected from each section, and 500 cells were counted and scored according to the immunoreactive score method. The presence of brownish-yellow granules in the nucleus or cytoplasm was recorded as CDC6 positive. Based on the percentage of positive cells, 0 point was assigned for < 25%, 1 point for 25-50%, 2 points for 50-75%, and 3 points for > 75%. The staining intensity was also categorized, with 1 point was assigned for no color, 2 points for light yellow, 3 points for brownish-yellow, and 4 points for dark brown. Both scores were multiplied to calculate a final score from 0 to 12, with < 6 being negative expression and ≥ 6 being positive expression.

Statistical analysis

Overall survival (OS) was defined as the time from the day of diagnosis to death due to any cause or the last follow-up. Progression-free survival (PFS) was defined as the time from the day of diagnosis to disease recurrence, progression, or death from any cause or last follow-up. The Pearson correlation analysis was performed between CDC6 level and Myc or Ki67 expression using transcriptomic data. A p < 0.05 on both sides was considered statistically significant. Data were analyzed by SPSS 17.0 statistical software, enumeration data were expressed as percentage (%), and χ2 test was used for comparison; measurement data were expressed as mean ± standard deviation (sd), and one-way analysis of variance was used to analyze the OD value, apoptosis rate, cell cycle and CDC6 mRNA of SUDHL4; independent sample t-test was used to analyze the relationship between CDC6 protein expression and clinicopathological characteristics of DLBCL; Kaplan-Meier method was used for survival curve analysis, and univariate analysis and comparison of survival curves were performed through log-rank test.

Results

Bioinformatic analysis of CDC6 in DLBCL

To explore the role of CDC6 in the DLBCL, we obtained transcriptomic data from TCGA and GTEX databases, and compared CDC6 expression levels between DLBCL patients and normal donors. We found that CDC6 was significantly upregulated in DLBCL compared with normal control (Fig. 1A). Interesting, using GSE10846 dataset from GEO database, we performed survival analysis and revealed that OS was significantly lower in DLBCL patients with high CDC6 expression than in those with low CDC6 expression (Fig. 1B). Moreover, there were positive correlations in expression levels between CDC6 and critical DLBCL-related markers, Myc and Ki67, respectively (Fig. 1C and D). Thus, in silico data suggest that CDC6 is overexpressed in DLBCL and is associated with inferior prognosis, which prompted us to investigate how CDC6 is involved in DLBCL pathogenesis.

Fig. 1
figure 1

Bioinformatic analysis shows that CDC6 is overexpressed in DLBCL. A, CDC6 expression is significantly higher in DLBCL patients than in healthy donors (control). **: p < 0.001. B, the OS curve of DLBCL patients with the high- and low-CDC6 expression. C and D, in terms of expression level, CDC6 positively correlated with Myc (C) and Ki67(D), respectively

Full size image

CDC6 expression and subcellular localization in B cell lymphoma cells

To alter CDC6 expression in vitro, lentiviral construct harboring CDC6 or shCDC6 was transfected to overexpress or knockdown CDC6 in SUDHL4 cells, and real-time quantitative PCR was used to measure the CDC6 mRNA levels. As shown in Fig. 2A, when compared with the control, LV-NC and LV-shCtrl did not affect CDC6 expression; LV-CDC6 significantly upregulated CDC6 mRNA, P < 0.001, while LV-shCDC6 led to significant decrease in CDC6 mRNA, P < 0.001. Immunofluorescence analysis showed that CDC6 protein was localized in both nucleus and cytoplasm of SUDHL4 cells. When compared with LV-NC and LV-shCtrl cells, the fluorescence intensities were increased in CDC6-overexpressed cells (LV-CDC6), but decreased in CDC6-knockdown (LV-shCDC6) cells (Fig. 2B).

Fig. 2
figure 2

CDC6 expression and subcellular localization in B cell lymphoma cells. A, parental SUHDL4 cells (control) were transfected with pLenO vector (LV-NC), pLenO-CDC6 (LV-CDC6), pLenR-GPH vector (LV-shCtrl) and pLenR-shCDC6 (LV-shCDC6), respectively; 72 h after transfection, total RNAs were purified for real-time quantitative PCR. The relative expression of CDC6 was normalized to that of GAPDH. B, immunofluorescence was performed as described under “material and method” CDC6 is stained as red, nuclei as blue

Full size image

CDC6 promotes B cell lymphoma cell proliferation

To determine whether CDC6 affects BCL cell proliferation, CCK-8 assay was performed with or without alteration of CDC6 expression in SUDHL4 cells. We found that the SUDHL4 cells overexpressing CDC6 (LV-CDC6) had a significantly higher proliferation activity, which was shown as OD value, than control cells (LV-NC) (Fig. 3A). Conversely, knockdown of CDC6 inhibited SUCHL4 cell proliferation in a time-dependent manner, since LV-shCDC6 cells led to significant OD value reduction when compared with LV-shCtrl cells (Fig. 3B). To determine if the CDC6-dependent proliferation is cell line-specific, we tested another BCL cell line, OCI-LY7. As shown in Fig. 3C, CDC6 overexpression rarely promote OCI-LY7 proliferation, which is common due to high basal level of CDC6; however, when CDC6 was knocked down, OCI-LY7 cell proliferation was markedly inhibited (Fig. 3D). These data suggest that CDC6 can promote BCL cell proliferation.

Fig. 3
figure 3

CDC6 promotes B cell lymphoma cell proliferation. A and C, SUHDL4 cells (A) and OCI-LY7 cells were transfected with pLenO vector (LV-NC) or pLenO-CDC6 (LV-CDC6) for 24, 48 and 72 h, respectively, and then subjected to CCK-8 assay. B and D, SUHDL4 cells (B) and OCI-LY7 (D) were transfected with pLenR vector (LV-shCtrl) or pLenR-shCDC6 (LV-shCDC6) for 24, 48 and 72 h, respectively, and followed by CCK-8 assay. ns, not significant; **, p < 0.05

Full size image

CDC6 regulates cell cycle progression and apoptosis in B cell lymphoma cells

To test whether CDC6 affects cell proliferation through regulation of cell cycle and/or apoptosis, we performed flow cytometric analysis and annexin V/7-AAD staining on SUDHL4 and OCI-LY7 cells with and without CDC6 alterations. When compared with control cells (LV-NC), SUDHL4 cells overexpressing CDC6 (LV-CDC6) showed a significant decrease in the percentage of G1 phase,71.89% vs. 59.72%, P < 0.05, but increase in S (15.68% vs. 19.72%) and G2 (12.43% vs. 20.86%) phases, both p < 0.05. Likewise, knockdown of CDC6 (LV-shCDC6) led to a significant increase in the percentage of G1 phase (71.95% vs. 77.47%) and decrease in G2 phase (13.14% vs. 6.55%) compared with control (LV-shRNA), both p < 0.05(Fig. 4A). In OCI-LY7 cells, CDC6 overexpression reduces the percentage of G1 phase, 58.59% vs. 52.15%, p < 0.05; knockdown of CDC6 increases the percentage of G1 phase, 58.10% vs. 64.51, p < 0.05 (Fig. 4B). These data suggest that CDC6 regulates the G1/S checkpoint of the cell cycle.

Fig. 4
figure 4

CDC6 regulates cell cycle progression and apoptosis in B cell lymphoma cells. A and B, SUHDL4 cells (A) and OCI-LY7 (B) were transfected with pLenO vector (LV-NC), pLenO-CDC6 (LV-CDC6), pLenR-GPH vector (LV-shCtrl) and pLenR-shCDC6 (LV-shCDC6) for 72 h, respectively, and cell cycle was analyzed by flow cytometry. C and D, cells were transfected as described in A and B, apoptosis was measured by flow cytometry following annexin V/7-AAD staining. E and F, SUHDL4 cells (E) and OCI-LY7 (F) cells transfected with pLenR vector (LV-shCtrl) or pLenO-shCDC6 (LV-shCDC6) for for 24, 48 and 72 h, respectively, and then apoptosis was evaluated. ns, not significant; **, p < 0.05

Full size image

Transfection of LV-NC, LV-ShCtrl or LV-CDC6 did not affect little if any cell apoptosis (Fig. 4C and D). When endogenous CDC6 was knocked down by LV-shCDC6 for 72 h, SUDHL4 cell apoptosis was increased from 3.18 to 31.24%, OCI-LY7 cell apoptosis increased from 8.99 to 23.18% (Fig. 4C and D); Furthermore, CDC6 knockdown induced significant cell apoptosis in a time-dependent manner, p < 0.05 (Fig. 4E F). Taken together, these data suggest that CDC6 is required for maintenance of BCL cell survival.

The mechanisms underlying CDC6 regulated cell cycle and apoptosis

To investigate the molecular mechanisms by which CDC6 regulates cell survival, western blot was used to apoptosis-related factors including Bcl-2 family and caspase 3. We found that CDC6 overexpression induced Bcl-2 expression but inhibited the expression of Bax, a pro-apoptotic molecule within bcl-2 family, accompanied by a decrease in caspase-3; knockdown of CDC6 decreased Bcl-2 but increased Bax and caspase-3 expression. Thus, CDC6 upregulates Bcl-2 and downregulates Bax and caspase-3, resulting in attenuation of apoptosis. (Figure 5A and B). To further characterize the cell cycle signaling pathway, we detected the expression of tumor suppressor genes INK4 and E-Cadherin. As shown in Fig. 5C and D, CDC6 repressed INK4 and E-cadherin expression, accompanied by reduction of ATR, a kinase involving DNA damage response. In addition, the expression of INK4, E-Cadherin and ATR were increased when CDC6 was knocked down (Fig. 5C and D).

Fig. 5
figure 5

CDC6 regulates downstream signalings related to cell cycle and apoptosis. A and B, SUHDL4 cells (A) and OCI-LY7 (B) were transfected with pLenO vector (LV-NC), pLenO-CDC6 (LV-CDC6), pLenR-GPH vector (LV-shCtrl) and pLenR-shCDC6 (LV-shCDC6) for 72 h, respectively, and the levels of CDC6, caspase-3, Bcl-2, Bax and GAPDH were analyzed by Western blot analysis. C and D, the experiments were performed as described in A and B, the cell lysates were collected and analyzed by western blot with antibodies against INK4, E-Cadherin, ATR, and GAPDH, respectively

Full size image

CDC6 is overexpressed and confers poor prognosis in DLBCL

To confirm the bioinformatic finding and determine the clinical significance of CDC6, CDC6 expression in DLBCL was compared with that in reactive hyperplasia of lymph nodes. CDC6 was stained as brownish-yellow granules that distribute in nucleus and cytoplasm of cells (Fig. 6A, B). The positive expression rate of CDC6 protein was 56.7% (34/60) in DLBCL and 25.0% (5/20) in lymph node reactive hyperplasia tissues, the difference of which was statistically significant, P = 0.014 (Table 1).

Fig. 6
figure 6

CDC6 is overexpressed and confers poor prognosis in DLBCL. A and B, Representative images of immunohistochemistry showing CDC6 expression in lymph node reactive hyperplasia (A) and DLBCL (B) tissues, EnVision method × 200. C and D, OS and PFS stratified by Hans classification. E and F, OS and PFS according to the status of CDC6 expression

Full size image
Table 1 CDC6 protein expression in DLBCL and reactive hyperplasia of lymph nodes
Full size table

We next wanted to know which clinicopathological features are associated with CDC6 expression, the DLBCL patients’ characteristics and CDC6 expression are summarized in Table 2. Only Hans classification was associated with CDC6 expression, as non-GCB DLBCL showed markedly higher CDC6 expression than GCB DLBCL; while patients’ sex, age, LDH level, hemoglobin, Ann Arbor staging, IPI score and nodal involvement did not affect CDC6 expression.

Table 2 CDC6 expression and baseline clinical characteristics in the patients with DLBCL
Full size table

To define the prognostic role of CDC6 in DLBCL, 60 patients with or without CDC6 expression were included for survival analysis. At a median follow up of 71 (range 39–131) months,46.7% (28/60) patients died, and mortality in CDC6-positive DLBCLs was higher than that in CDC6 negative DLBCLs, with deaths reported in 55.9% (19/34) and 34.6% (9/26) of patients, respectively, P = 0.102. Overall, the mean OS was 74.7 ± 7.2 months, and the mean PFS was 70.3 ± 7.6 months. As expected, patients with GCB subtype had superior OS and PFS than those with non-GCB subtype, 105.8 ± 8.3 vs. 51.9 ± 7.8 months (P = 0.001) and 104.3 ± 8.9 vs. 36.7 ± 6.1 months (P = 0.001), respectively (Fig. 6C, D). When compared with CDC6-negative DLBCL, CDC6-positive DLBCL resulted in significantly poorer OS and PFS, 57.7 ± 9.2 vs. 92.0 ± 9.1 months (P < 0.05) and 54.6 ± 9.5 vs. 87.1 ± 10.3 months (P < 0.05), respectively (Fig. 6E, F).

Discussion

DNA replication is a fundamental biological process that is tightly coordinated with cell division to maintain genomic integrity. Dysfunction of DNA replication machinery results in genomic instability, which make normal cells vulnerable to malignant transformation [9]. CDC6 is an essential regulator of DNA replication in eukaryotic cells [10, 11]. It mainly involves in the assembly of the “pre-replication complex (pre-RC)” during G1 phase, and also regulate G2/M checkpoint through Chk1 activation, thereby ensuring proper cell cycle progression [12, 13]. Thus, aberrant CDC6 expression will compromise normal DNA replication and cause cell cycle dysregulation, which is closely related to tumorigenesis [14, 15]. For instance, CDC6 overexpression enables repeated DNA replication, resulting in genomic instability and oncogene activations [16, 17]. CDC6 activates G2/M phase replication checkpoint through CDC6-ATR-Chk1 signaling to promote the survival of cancer cells [18, 19]. CDC6 is indispensable for KRAS-induced cell transformation [20].

DLBCL is an aggressive lymphoid malignancy characterized by highly heterogeneous pathological features and clinical outcomes, integration of novel biomarkers will provide opportunity for individualized or precision treatment. In this study, for the first time we found that CDC6 expression was increased in DLBCL compared with reactive lymphocytic hyperplasia, CDC6 overexpression was often seen in non-GCB subtype and predicted adverse prognosis in patients with DLBCL. It has shown that CDC6 is overexpressed in several cancers such as lung [21], breast [8], ovarian [22] and prostate cancers [23] as well as chronic myelogenous leukemia [24]. CDC6 overexpression can result from gene amplification, E2F1/2 upregulation [15, 21] and alternative splicing, the latter of which predominantly generates a short CDC6 isoform resistant to degradation due to the loss of microRNA(miRNA)-binding sites in its 3’untranslated regions [25]. Interestingly, Cdc6 G1321A polymorphism (V441I, rs13706) was found to affect the risk of B cell lymphoma, and the AG or combined AA/AG genotype was associated with decreased risk for DLBCL, possibly through modulating mRNA secondary structure [26]. Therefore, it is necessary to further investigate the mechanisms underlying CDC6 overexpression and whether gene polymorphism affects CDC6 protein expression in DLBCL.

Given the important role CDC6 play in DLBCL pathogenesis, we provide preliminary evidence supporting CDC6 as a potential therapeutic target. In SUDHL4 cells, CDC6 knockdown induces cell cycle arrest and apoptosis, which is consistent with previous studies in other cancer types [27,28,29]. In this study, we found that after CDC6 overexpression, ATR was down-regulated, and cell cycle showed a decrease G1 phase and an increase in G2 phase. ATR protein, a kinase involving in cell cycle regulation, was up-regulated upon CDC6 knockdown, leading to cell cycle arrest in G1 phase. When CDC6 inhibition persisted longer, pro-apoptotic Bax increased, anti-apoptotic Bcl-2 decreased, and caspase 3 was activated to induce cell apoptosis of SUDHL4 cells. A variety of CDC6 downstream signaling pathways contribute to the dysregulation of cell cycle and proliferation in cancer [30]. CDC6 regulate cell cycle transition from G1 to S phase through prompting ATR to bind to chromatin, activating cell cycle checkpoints [31, 32]; meanwhile, CDC6 is also a key regulator of G2/M checkpoint, and overexpression of CDC6 in G2 phase can prevent cell cycle progression to M phase by activating Chk1 [33,34,35]. Consistent with previous findings [28, 36], we found that, INK4 and E-cadherin were down-regulated when CDC6 was overexpressed, while increased after CDC6 knockdown, suggesting that CDC6 promotes lymphomagenesis through transcriptional repression of tumor suppressor genes. Feng et al. [27] demonstrated that knockdown of CDC6 led to tumor cell apoptosis, but did not affect normal cells, regardless of p53 mutation in cancer [34]. Karanika et al. [19] reported that silencing CDC6 synergized with Chk1/2 inhibitor to kill prostate cancer cells. It is tempting to test if targeting CDC6 could overcome the adverse impact of p53 mutation in DLBCL, and if CDC6 inhibition could synergize with CHK1/2 inhibitor in DLBCL treatment.

In summary, we found that CDC6 is often overexpressed in DLBCL, and it may play a role in the development of DLBCL and serves as an adverse prognosis factor. CDC6 promotes lymphoma cell survival and prevents cell apoptosis, possibly through cell cycle regulation, Bcl2 upregulation and downregulation of Bax and INK4 and E-cadherin. Our data support CDC6 as a potential novel target for B cell lymphoma treatment, which needs to be further explored.

Data availability

The datasets generated and/or analyzed during the current study are included in this published article and its supplementary information files. We used two series of DLBCL from 2 different databases: (1) The transcriptomic data of 47 DLBCL patients and 337 normal donors were obtained from The Cancer Genome Atlas (TCGA; https://cancergenome.nih.gov/) database and the Genotype-Tissue Expression (GTEX; https://gtexportal.org), respectively; (2) The CDC6 transcriptional expression and relevant survival information obtained from the Gene Expression Omnibus (GEO) (https://www.ncbi.nlm.nih.gov/geo/, accession number: GSE10846).

References

  1. Susanibar-Adaniya S, Barta SK. 2021 Update on Diffuse large B cell lymphoma: A review of current data and potential applications on risk stratification and management. Am J Hematol. 2021;96(5):617–629.

  2. Sehn LH, Salles G. Diffuse large B-Cell lymphoma. N Engl J Med. 2021;384(9):842–58.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  3. Zelenetz AD, Gordon LI, Chang JE, et al. NCCN Guidelines(R) insights: B-Cell Lymphomas, Version 5.2021. J Natl Compr Canc Netw. 2021;19(11):1218–30.

    Article  PubMed  Google Scholar 

  4. Hans CP, Weisenburger DD, Greiner TC, et al. Confirmation of the molecular classification of diffuse large B-cell lymphoma by immunohistochemistry using a tissue microarray. Blood. 2004;103(1):275–82.

    Article  CAS  PubMed  Google Scholar 

  5. Lim N, Townsend PA. Cdc6 as a novel target in cancer: oncogenic potential, senescence and subcellular localisation. Int J Cancer. 2020;147(6):1528–34.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  6. Boyer AS, Walter D, Sorensen CS. DNA replication and cancer: from dysfunctional replication origin activities to therapeutic opportunities. Semin Cancer Biol. 2016;37–38:16–25.

    Article  PubMed  Google Scholar 

  7. Cai J, Wang H, Jiao X, et al. The RNA-Binding protein HuR confers Oxaliplatin Resistance of Colorectal Cancer by upregulating CDC6. Mol Cancer Ther. 2019;18(7):1243–54.

    Article  CAS  PubMed  Google Scholar 

  8. Mahadevappa R, Neves H, Yuen SM, et al. The prognostic significance of Cdc6 and Cdt1 in breast cancer. Sci Rep. 2017;7(1):985.

    Article  PubMed  PubMed Central  Google Scholar 

  9. Petrakis TG, Komseli ES, Papaioannou M, et al. Exploring and exploiting the systemic effects of deregulated replication licensing. Semin Cancer Biol. 2016;37–38:3–15.

    Article  PubMed  Google Scholar 

  10. Petrakis TG, Vougas K, Gorgoulis VG. Cdc6: a multi-functional molecular switch with critical role in carcinogenesis. Transcription. 2012;3(3):124–9.

    Article  PubMed  PubMed Central  Google Scholar 

  11. Borlado LR, Mendez J. CDC6: from DNA replication to cell cycle checkpoints and oncogenesis. Carcinogenesis. 2008;29(2):237–43.

    Article  CAS  PubMed  Google Scholar 

  12. Yi ZY, Meng TG, Ma XS, et al. CDC6 regulates both G2/M transition and metaphase-to-anaphase transition during the first meiosis of mouse oocytes. J Cell Physiol. 2020;235(7–8):5541–54.

    Article  CAS  PubMed  Google Scholar 

  13. Ofir Y, Sagee S, Guttmann-Raviv N, et al. The role and regulation of the preRC component Cdc6 in the initiation of premeiotic DNA replication. Mol Biol Cell. 2004;15(5):2230–42.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  14. Hossain M, Stillman B. Opposing roles for DNA replication initiator proteins ORC1 and CDC6 in control of cyclin E gene transcription. Elife. 2016;5:e12785.

    Article  PubMed  PubMed Central  Google Scholar 

  15. Liontos M, Koutsami M, Sideridou M, et al. Deregulated overexpression of hCdt1 and hCdc6 promotes malignant behavior. Cancer Res. 2007;67(22):10899–909.

    Article  CAS  PubMed  Google Scholar 

  16. Petropoulos M, Champeris Tsaniras S, et al. Replication licensing aberrations, replication stress, and genomic instability. Trends Biochem Sci. 2019;44(9):752–64.

    Article  CAS  PubMed  Google Scholar 

  17. Dobbelstein M, Sorensen CS. Exploiting replicative stress to treat cancer. Nat Rev Drug Discov. 2015;14(6):405–23.

    Article  CAS  PubMed  Google Scholar 

  18. Chen S, Chen X, Xie G, et al. Cdc6 contributes to cisplatin-resistance by activation of ATR-Chk1 pathway in bladder cancer cells. Oncotarget. 2016;7(26):40362–76.

    Article  PubMed  PubMed Central  Google Scholar 

  19. Karanika S, Karantanos T, Li L, et al. Targeting DNA damage response in prostate Cancer by inhibiting androgen Receptor-CDC6-ATR-Chk1 signaling. Cell Rep. 2017;18(8):1970–81.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  20. Steckel M, Molina-Arcas M, Weigelt B, et al. Determination of synthetic lethal interactions in KRAS oncogene-dependent cancer cells reveals novel therapeutic targeting strategies. Cell Res. 2012;22(8):1227–45.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  21. Karakaidos P, Taraviras S, Vassiliou LV, et al. Overexpression of the replication licensing regulators hCdt1 and hCdc6 characterizes a subset of non-small-cell lung carcinomas: synergistic effect with mutant p53 on tumor growth and chromosomal instability–evidence of E2F-1 transcriptional control over hCdt1. Am J Pathol. 2004;165(4):1351–65.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  22. Deng Y, Jiang L, Wang Y, et al. High expression of CDC6 is associated with accelerated cell proliferation and poor prognosis of epithelial ovarian cancer. Pathol Res Pract. 2016;212(4):239–46.

    Article  CAS  PubMed  Google Scholar 

  23. Kim YH, Byun YJ, Kim WT, et al. CDC6 mRNA expression is Associated with the aggressiveness of prostate Cancer. J Korean Med Sci. 2018;33(47):e303.

    Article  PubMed  PubMed Central  Google Scholar 

  24. Zhang JH, He YL, Zhu R, et al. Deregulated expression of Cdc6 as BCR/ABL-dependent survival factor in chronic myeloid leukemia cells. Tumour Biol. 2017;39(6):1010428317713394.

    Article  PubMed  Google Scholar 

  25. Akman BH, Can T, Erson-Bensan AE. Estrogen-induced upregulation and 3’-UTR shortening of CDC6. Nucleic Acids Res. 2012;40(21):10679–88.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  26. Xiong XD, Qiu FE, Fang JH, et al. Association analysis between the Cdc6 G1321A polymorphism and the risk for non-hodgkin lymphoma and hepatocellular carcinoma. Mutat Res. 2009;662(1–2):10–5.

    Article  CAS  PubMed  Google Scholar 

  27. Feng D, Tu Z, Wu W, et al. Inhibiting the expression of DNA replication-initiation proteins induces apoptosis in human cancer cells. Cancer Res. 2003;63(21):7356–64.

    CAS  PubMed  Google Scholar 

  28. Sideridou M, Zakopoulou R, Evangelou K, et al. Cdc6 expression represses E-cadherin transcription and activates adjacent replication origins. J Cell Biol. 2011;195(7):1123–40.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  29. Jiang W, Yu Y, Liu J, et al. Downregulation of Cdc6 inhibits tumorigenesis of osteosarcoma in vivo and in vitro. Biomed Pharmacother. 2019;115:108949.

    Article  CAS  PubMed  Google Scholar 

  30. Liu Y, Hock JM, Sullivan C, et al. Activation of the p38 MAPK/Akt/ERK1/2 signal pathways is required for the protein stabilization of CDC6 and cyclin D1 in low-dose arsenite-induced cell proliferation. J Cell Biochem. 2010;111(6):1546–55.

    Article  CAS  PubMed  Google Scholar 

  31. Cook JG, Chasse DA, Nevins JR. The regulated association of Cdt1 with minichromosome maintenance proteins and Cdc6 in mammalian cells. J Biol Chem. 2004;279(10):9625–33.

    Article  CAS  PubMed  Google Scholar 

  32. Niimi S, Arakawa-Takeuchi S, Uranbileg B, et al. Cdc6 protein obstructs apoptosome assembly and consequent cell death by forming stable complexes with activated Apaf-1 molecules. J Biol Chem. 2012;287(22):18573–83.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  33. Clay-Farrace L, Pelizon C, Santamaria D, et al. Human replication protein Cdc6 prevents mitosis through a checkpoint mechanism that implicates Chk1. EMBO J. 2003;22(3):704–12.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  34. Lau E, Zhu C, Abraham RT, et al. The functional role of Cdc6 in S-G2/M in mammalian cells. EMBO Rep. 2006;7(4):425–30.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  35. Yoshida K, Sugimoto N, Iwahori S, et al. CDC6 interaction with ATR regulates activation of a replication checkpoint in higher eukaryotic cells. J Cell Sci. 2010;123(Pt 2):225–35.

    Article  CAS  PubMed  Google Scholar 

  36. Gonzalez S, Klatt P, Delgado S, et al. Oncogenic activity of Cdc6 through repression of the INK4/ARF locus. Nature. 2006;440(7084):702–6.

    Article  CAS  PubMed  Google Scholar 

Download references

Acknowledgements

We thank for providing all samples and all tests for this research. We would like to thank all patients whom participated in this study.

Funding

This work was supported by the Zhejiang Medical and Health Science and Technology Plan Project (2019KY693).

Author information

Authors and Affiliations

  1. Department of Hematology, the First Hospital of Jiaxing, 314001, Zhejiang, China

    Mingfang Shen, Yunfeng Zhang, Lun Tang, Qinyan Fu, Hui Zeng & Yuan Li

  2. Department of Hematology, the Second Affiliated Hospital, Zhejiang University School of Medicine, 310009, Zhejiang, China

    Jiawei Zhang & Yang Xu

Authors
  1. Mingfang Shen
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Yunfeng Zhang
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Lun Tang
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Qinyan Fu
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Jiawei Zhang
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Yang Xu
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. Hui Zeng
    View author publications

    You can also search for this author in PubMed Google Scholar

  8. Yuan Li
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

The study was designed by YL and HZ. MS, YZ, LT and QF did the experiments, performed data analysis and interpretation. JZ did the bioinformatic analysis and prepared Fig. 1; MS, YZ and JZ wrote the main manuscript text and prepared Figs. 2, 3, 4, 5 and 6. YL, HZ and YX critically revised it for important intellectual content. All authors reviewed and approved the final manuscript.

Corresponding authors

Correspondence to Hui Zeng or Yuan Li.

Ethics declarations

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Ethics approval and consent to participate

This study and all experimental protocols were approved by the institutional review board of the First Hospital of Jiaxing. All methods were carried out in accordance with relevant guidelines and local regulations. Informed consent was obtained from all patients in this study.

Consent for publication

Not applicable.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Electronic supplementary material

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Shen, M., Zhang, Y., Tang, L. et al. CDC6, a key replication licensing factor, is overexpressed and confers poor prognosis in diffuse large B-cell lymphoma. BMC Cancer 23, 978 (2023). https://doi.org/10.1186/s12885-023-11186-6

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s12885-023-11186-6

Keywords

BMC Cancer

ISSN: 1471-2407

Contact us