Skip to main content

Primary paediatric epidural sarcomas: molecular exploration of three cases



Primary paediatric epidural sarcomas are extremely rare. Overall, there remains a paucity of knowledge in paediatric epidural sarcomas owing to the infrequent number of cases. The Archer FusionPlex Sarcoma Kit (ArcherDX, Inc) is a next-generation sequencing assay that has been reported to be a useful technique to detect recurrent fusion in sarcomas. We report the molecular exploration of 3 primary paediatric epidural sarcomas—one in the cranium (mesenchymal chondrosarcoma) and 2 in the spine (mesenchymal chondrosarcoma and Ewing sarcoma respectively).

Case presentation

This is a study approved by the hospital ethics board. Clinico-pathological information from 3 consenting patients with primary epidural sarcomas was collected. These selected tumours are interrogated via Archer FusionPlex Sarcoma Kit (ArcherDX, Inc) for genomic aberrations. Results were validated with RT-PCR and Sanger sequencing. All findings are corroborated and discussed in concordance with current literature. Our findings show 2 variants of the HEY1-NCOA2 gene fusion: HEY1 (exon 4)-NCOA2 (exon 13) and HEY1 (exon 4)-NCOA2 (exon 14), in both mesenchymal chondrosarcoma patients. Next, the Ewing sarcoma tumour is found to have EWSR1 (exon 10)-FLI1 (exon 8) translocation based on NGS. This result is not detected via conventional fluorescence in situ testing.


This is a molecularly-centered study based on 3 unique primary paediatric epidural sarcomas. Our findings to add to the growing body of literature for these exceptionally rare and malignant neoplasms. The authors advocate global collaborative efforts and in-depth studies for targeted therapy to benefit affected children.

Peer Review reports


Primary paediatric epidural sarcomas are extremely rare and little is known about such tumours. Gene fusions are an important category of driver mutations in paediatric sarcomas [1]. While well-characterized and commonly occurring gene fusions can be identified by standard laboratory assays such as FISH and RT-PCR, an advanced technique such as next-generation sequencing (NGS) is often required to identify rare or novel gene fusions [2]. Gene fusion identification serves to confirm a pathological diagnosis, and is also important in relation to treatment as certain gene fusions have drug-targetable domains [3].

In this study, we report clinical, pathological and molecular features of three unique epidural sarcomas presenting with neurological compromise located in the cranium and spine. We describe the use of a next-generation sequencing-based assay (Archer FusionPlex Sarcoma assay (ArcherDX, Inc)) as a technique to identify gene fusions in these three primary paediatric epidural sarcomas [2, 4, 5].

Case presentation

Case 1: Cranial epidural mesenchymal chondrosarcoma

A previously well 11-year-old female presented with progressively worsening headaches associated with bilateral papilledema. An MRI brain reported a large, heterogeneously enhancing fronto-temporal extra-axial lesion supplied by the right middle meningeal artery. The lesion was resected. Histology showed a mesenchymal chondrosarcoma featuring crowded sheets of primitive spindle to round tumour cells admixed with interspersed islands of neoplastic cartilage demonstrating foci of hyalinization and secondary ossification. Tumour cells were immunoreactive for CD99 but negative for epithelial membrane antigen and progesterone receptor. Ki-67 proliferation index was 1 to 2%. (Fig. 1). The Archer™ FusionPlex Sarcoma Assay detected 2 gene fusion transcripts: HEY1 (exon 4)-NCOA2 (exon 13) and HEY1 (exon 4)-NCOA2 (exon 14) (Fig. 2a and 3).

Fig. 1
figure 1

Representative post-contrast T1-weighted MRI images in axial (a) and coronal (b) demonstrating a right extra-axial, fronto-temporal lesion causing mass effect and midline shift. c Haematoxylin and eosin stain slide (× 100) shows tumour tissue with a bimorphic pattern, composed of primitive-looking spindle and round cells interspersed with islands of neoplastic cartilage. In many areas, the cartilage demonstrates hyalinization and secondary ossification

Fig. 2
figure 2

Representative post-contrast T1-weighted MRI images in sagittal (a) and axial (b) demonstrating an enhancing intradural, extramedullary lesion with dura thickening at L2. c Haematoxylin and eosin stain slide (× 100) depicting round to spindle cells, in association with cartilage and bone formation

Fig. 3
figure 3

a Analysis of anchored multiplex PCR result of the Archer FusionPlex Sarcoma Panel for Patient 1. This illustrates a HEY1 exon 4 and NCOA2 exon 13 fusion, with Reads (#/%) of 86/ 68.3; and a HEY1 exon 4 and NCOA2 exon 14 fusion, with Reads (#/%) of 81/ 30. b Analysis of anchored multiplex PCR result of the Archer FusionPlex Sarcoma Panel for Patient 2. This illustrates a HEY1 exon 4 and NCOA2 exon 13 fusion, with Reads (#/%) of 1081/ 92.8; and a HEY1 exon 4 and NCOA2 exon 14 fusion, with Reads (#/%) of 86/ 5.4. The red arrows in both (a) and (b) indicate the nucleotide location of the gene-specific primers for NCOA2 gene used in the Archer FusionPlex Sarcoma Panel

Case 2: Lumbar intradural extramedullary mesenchymal chondrosarcoma

A 12-year-old female complained of persistent lower back pain associated with bilateral lower limb radicular symptoms over a 4-month duration. The MRI lumbar spine demonstrated an enhancing intradural, extramedullary lesion with adjacent dura thickening at the level of L2. Laminectomy and excision of the lesion was performed. Histology showed a mesenchymal chondrosarcoma featuring round to spindle cells with interspersed cartilage and bone formation. Tumour cells showed diffuse CD99 immunoreactivity and negative staining for epithelial membrane antigen, STAT6 and glial fibrillary acid protein. The Ki-67 index was about 30%. (Fig. 4). Similar to the previous case, the Archer™ FusionPlex Sarcoma Assay detected 2 gene fusion transcripts: HEY1 (exon 4)-NCOA2 (exon 13) and HEY1 (exon 4)-NCOA2 (exon 14) (Fig. 2b).

Fig. 4
figure 4

Sanger sequencing of the RT-PCR amplicon products for Patient 1 confirm the presence of both variants (a) and (b) of HEY1-NCOA2 gene fusion

Case 3: Thoracic intradural extramedullary Ewing sarcoma

An 11-year-old female presented with a 3-day history of acutely worsening lower limb weakness, numbness, urinary retention and lax anal tone. There was no prior history of associated trauma or injury, and no complaints of back pain. MRI spine revealed an extramedullary extradural soft tissue mass spanning T6 to T9 and causing moderate to severe spinal canal stenosis. This mass was heterogeneously enhancing with suggestion of a dural tail. She underwent emergency T7 to T9 laminectomy and excision of tumour. Histopathology reported a malignant round cell neoplasm with CD99 immunopositivity consistent with Ewing sarcoma (Fig. 5). Fluorescence in situ (FISH) with an EWSR1 break-apart probe was unexpectedly negative. This FISH test was performed twice with different sections of the tumour. However, the Archer™ FusionPlex Sarcoma Assay reported a EWSR1 (exon 10)-FLI1(exon 8) translocation (Fig. 6).

Fig. 5
figure 5

Representative post-contrast T1-weighted MRI images in sagittal (a) and axial (b) demonstrating a heterogeneously enhancing T6 to T9 extramedullary, extradural soft tissue mass with suggestion of a dural tail. c Haematoxylin and eosin stain slide (× 100) illustrating a malignant round cell neoplasm. d Immunohistochemistry slide (× 100) shows positivity for CD99

Fig. 6
figure 6

(a) Analysis of anchored multiplex PCR result of the Archer™ FusionPlex Sarcoma Panel for Case 3. This shows a EWSR1 exon 10 and FLI1 exon 8 gene fusion with Reads (#/%) of 1594/ 53.7. (b) Subsequent Sanger sequencing of the RT-PCR amplicon product confirms the presence of EWSR1 (exon 10)-FLI1(exon 8)

Study outline and experimental details

This was a single-institution, retrospective study approved by our hospital ethics review board. All patients’ legal guardians (as they are below 21 years old) provided signed informed consent for the research use of their medical data and pathological material obtained as part of their routine clinical data, and publication. The project is exploratory in design, and included 3 patients less than 18 years of age with a histopathological diagnosis of epidural sarcoma.

Total RNA was extracted from macro-dissected tissue sections using the Promega ReliaPrep™ FFPE Total RNA Miniprep System (Promega, USA) as per manufacturer’s protocol. The quantity of extracted RNA was measured using the QuantiFluor® RNA System (Promega, USA). Archer™ FusionPlex Sarcoma Assay is an RNA-based targeted sequencing assay that can identify fusions involving any of 26 sarcoma-related genes (ALK, CAMTA1, CCNB3, CIC, EPC, EWSR1, FKHR, FUS, GLI1, HMGA2, JAZF1, MEAF6, MKL2, NCOA2, NTRK3, PDGFB, PLAG1, ROS1, SS18, STAT6, TAF15, TCF12, TFE3, TFG, USP6, YWHAE) without prior knowledge of fusion partners or breakpoints. 150 ng of RNA was used for library preparation utilizing the Archer® FusionPlex® Sarcoma Panel kit (AK00328) following the manufacturer’s protocol (ArcherDX, USA). The prepared library was sequenced using an Ion Torrent PGM™ next-generation sequencer. The Hi-Q™ sequencing kit and Hi-Q™ View CHEF kit were used according to the manufacturer’s protocol (Life Technologies, USA). Data was analyzed by the Archer Data Analysis (version 5.1.0) portal (ArcherDX, USA). Confirmatory RT-PCR and Sanger Sequencing on the amplicon product were performed to confirm the fusion variant. Two separate confirmatory RT-PCR using primers for HEY1/NCOA2 (4–13) – 5′ CGAGATCCTGCAGATGACC 3′ (forward), 5′ GAGGTATCACTGAGTAGGGACTA (reverse)- and HEY1/NCOA2 (4–14) – 5′ CGAGATCCTGCAGATGACC 3′ (forward), 5′ CTGCTGGGTTCCGAATCATA (reverse)- flanking the breakpoint, and Sanger Sequencing on the amplicon products were performed to confirm the fusion variant. For the thoracic epidural tumour, confirmatory RT-PCR using primers – 5′ GAGCGAGGTGGCTTCAATAA 3′ (forward), 5′ GGTTGGCTAGGCGACTG (reverse)- flanking the breakpoint, and Sanger Sequencing on the amplicon product was performed to confirm the fusion variant.


Childhood sarcomas occurring in the CNS children are rare and poorly understood. To begin with, mesenchymal chondrosarcoma (MCS) is an infrequent member of the heterogeneous sarcoma family of tumours [6]. Presently, its developmental mechanisms remain poorly understood. Clinical experience with CNS-related MCS is also extremely limited; nonetheless, local recurrence and distant metastasis has been reported [7]. Presently, CNS-based MCS has only been reflected in surgical case reports and small series in the literature [7,8,9,10,11,12,13,14,15]. Recently, the HEY1 (exon 4)-NCOA2 (exon 13) gene fusion is reported as a recurrent event unique to all MCS [16, 17]. In this study, we report 2 variant gene fusions HEY1 (exon 4)-NCOA2 (exon 13) and HEY1 (exon 4)-NCOA2 (exon 14) in two of our MCS patients. With reference to current literature, only HEY1 (exon 4)-NCOA2 (exon 13) gene fusion has been previously reported as a recurrent event unique to MCS [16, 17]. However, the concurrent HEY1 (exon 4)-NCOA2 (exon 14) fusion found in both of our CNS cases has not been previously described.

At this point in time, it is hard to postulate if this result is unique to CNS-based MCS patients, or to other MCS tumours found in the rest of the body. In addition, the concurrent occurrence of these 2 transcripts is intriguing. Firstly, there is a possibility that a splicing event has given rise to the two variant gene fusions. Nonetheless, as the breakpoints involve different exons, this is not a usual alternative splicing phenomenon. Next, this phenomenon may be biallelic in that there are two variants of the gene fusion occurring in each of the two copies of the genes. Functional validation at of these findings is required to elucidate their biological meaning. Furthermore, in the context of our patients, there is a role to explore if having 2 aberrant gene fusion variants implies increased oncogenicity in these rare tumours.

Following in the footsteps of scarcity, primary epidural Ewing sarcoma (EWS) is too, very rare in the EWS family of solid tumours. For our third patient, the Archer™ FusionPlex Sarcoma Assay detected EWSR1 (exon 10)-FLI1(exon 8) translocation.. EWS/FLI has at least 10 different isoforms [18]; The most common are: type 1 [EWSR1 (exon 7)-FLI1(exon 6)], type 2 [EWSR1 (exon 7)-FLI1(exon 5)], type 3 [EWSR1 (exon 10)-FLI1(exon 6)] and type 4 [EWSR1 (exon 7)-FLI1(exon 7)] translocations [18]. Here, our result represents an uncommon variant in the cohort of EWSR1-FLI1 translocation breakpoints.

Broadly speaking, non-osseous forms of EWS, particularly those that originate in the epidural space, make up to approximately 20 case reports in the literature [19,20,21]. Next, EWS is notorious for multiple fusion combinations involving several partner genes [22]. To complicate matters, the specific breakpoint in each partner gene can be variable, resulting in a variety of exon-exon fusion combinations at the transcript level [23]. At this point, we remain uncertain if individual fusion isoforms portend different patient outcomes [24, 25]. However, most are in agreement that detection of translocations at the exon level will have implications for diagnosis, prognosis and treatment of EWS patients [18]. In the context of our patient, the gene fusion EWSR1 (exon 10)-FLI1(exon 8) was investigated using a EWSR1 break-apart probe that could detect a range of EWSR1 gene disruptions. The probes included the translocation region of interest. However, this particular gene fusion was only detectable using NGS methods, and not via FISH. Despite its proven reliability as diagnostic method, FISH is reputed to have a very small risk of false negative results [26]. This technical limitation has been reported to be especially exemplified by EWS [26, 27], as the FISH technique relies on the identification of gene rearrangements to which probes are very specifically directed [18]. For our patient’s case, the consideration may be for multi-color FISH with more than 2 different probes [28]. Under such circumstances, obscure translocations that lead EWSR1 insertion into partner genes may be more readily detectable. However, this particular type of FISH testing is not readily available at our institution. Hence, this case highlights the utility of novel genomic advancements as a clinical tool in challenging cases. It should too, be emphasized that selected patients may proceed to be studied by more than one diagnostic modality, especially if the initial test is negative and the clinical features point to a high probability of genetic aberrations [29].

In general, paediatric cancers appear to be the consequence of chromosomal rearrangements, rather than mutation events [3]. Detection and characterization of gene fusions has been of great importance for clinical purposes, as well as for understanding tumorigenesis [30]. Furthermore, it has been reported that sarcoma patients whose tumours were interrogated by NGS as part of their clinical management received the option of access to targeted agents in their treatment [31]. This is because a difference in clinical outcome may be predicted by one or more of the following: firstly, incidence of a specific fusion; next, the presence of one or more variants of a fusion; or finally, the presence of one of a heterogeneous group of unrelated fusions [32, 33]. More significantly, as the cases in discussion are rare paediatric tumours, an isolated fusion found in a single patient can be important, especially for future therapeutic targeting [3]. Identification of specific fusion transcripts, including unusual variants of gene-related splices may help in the development of novel therapeutics to block their aberrant activity in cancer cells [34].

Study critique and future directions

The authors acknowledge that there are limitations that should be highlighted in this study. First and foremost, this is a retrospective study with a small number of cases. However, it should be emphasized that primary paediatric epidural sarcomas are extremely rare. Hence, given the infrequency of such patients, every case should be regarded as significant. Moving forward, the role of functional studies to determine the clinico-pathological relevance of gene fusions in this subset of location-specific sarcomas is paramount.


In summary, the authors describe the molecular experience of 3 paediatric epidural sarcomas, in corroboration with current disease understanding and techniques. The identification of gene fusions may offer insights into the biology of these exceptionally rare neoplasms; and more importantly, bear clinical relevance for future targeted therapy. The authors advocate multi-disciplinary, collaborative efforts at a global level to benefit children afflicted with these malignant tumors.



Central nervous system


Ewing sarcoma


Mesenchymal chondrosarcoma


Magnetic resonance imaging


Next-generation sequencing


  1. Mertens F, Johansson B, Fioretos T, Mitelman F. The emerging complexity of gene fusions in cancer. Nat Rev Cancer. 2015;15(6):371–81.

    CAS  Article  Google Scholar 

  2. Szurian K, Kashofer K, Liegl-Atzwanger B. Role of next-generation sequencing as a diagnostic tool for the evaluation of bone and soft-tissue tumors. Pathobiology. 2017;84(6):323–38.

    CAS  Article  Google Scholar 

  3. Dupain C, Harttrampf AC, Urbinati G, Geoerger B, Massaad-Massade L. Relevance of fusion genes in pediatric cancers: toward precision medicine. Mol Ther Nucleic Acids. 2017;6:315–26.

    CAS  Article  Google Scholar 

  4. Mok Y, Pang YH, Sanjeev JS, Kuick CH, Chang KT. Primary renal hybrid low-grade Fibromyxoid sarcoma-Sclerosing epithelioid Fibrosarcoma: an unusual pediatric case with EWSR1-CREB3L1 fusion. Pediatr Dev Pathol. 2018;21(6):574–9.

    Article  Google Scholar 

  5. Lam SW, Cleton-Jansen AM, Cleven AHG, Ruano D, van Wezel T, Szuhai K, Bovee J. Molecular analysis of gene fusions in bone and soft tissue tumors by anchored multiplex PCR-based targeted next-generation sequencing. J Mol Diagn : JMD. 2018;20(5):653–63.

    CAS  Article  Google Scholar 

  6. Dantonello TM, Int-Veen C, Leuschner I, Schuck A, Furtwaengler R, Claviez A, Schneider DT, Klingebiel T, Bielack SS, Koscielniak E, et al. Mesenchymal chondrosarcoma of soft tissues and bone in children, adolescents, and young adults: experiences of the CWS and COSS study groups. Cancer. 2008;112(11):2424–31.

    Article  Google Scholar 

  7. Lin L, Varikatt W, Dexter M, Ng T. Diagnostic pitfall in the diagnosis of mesenchymal chondrosarcoma arising in the central nervous system. Neuropathology. 2012;32(1):82–90.

    Article  Google Scholar 

  8. Agrawal P, Gupta A, Juneja S, Gupta V. Intracranial Mesenchymal Chondrosarcoma: A Case Report. Indian J Neurosurg. 2015;4:31–4.

    Article  Google Scholar 

  9. Andersson C, Osterlundh G, Enlund F, Kindblom LG, Hansson M. Primary spinal intradural mesenchymal chondrosarcoma with detection of fusion gene HEY1-NCOA2: a paediatric case report and review of the literature. Oncol Lett. 2014;8(4):1608–12.

    Article  Google Scholar 

  10. Anvari K, Gharib M, Sanburi A, Javadina SA. Intracranial mesenchymal chondrosarcoma: case report and review of literature. GMJ. 2016;5(4):219–24.

    Google Scholar 

  11. Di Lorenzo N, Palatinsky E, Artico M, Palma L. Dural mesenchymal chondrosarcoma of the lumbar spine. Case report. Surg Neurol. 1989;31(6):470–2.

    Article  Google Scholar 

  12. Zucker DK, Horoupian DS. Dural mesenchymal chondrosarcoma. Case report. J Neurosurg. 1978;48(5):829–33.

    CAS  Article  Google Scholar 

  13. Zibis AH, Wade Shrader M, Segal LS. Case report: mesenchymal chondrosarcoma of the lumbar spine in a child. Clin Orthop Relat Res. 2010;468(8):2288–94.

    Article  Google Scholar 

  14. Scheithauer BW, Rubinstein LJ. Meningeal mesenchymal chondrosarcoma: report of 8 cases with review of the literature. Cancer. 1978;42(6):2744–52.

    CAS  Article  Google Scholar 

  15. Sajjad EA, Sikora K, Paciejewski T, Garbicz F, Paskal W, Szacht M, Grajkowska W, Wlodarski PK. Intraparenchymal mesenchymal chondrosarcoma of the frontal lobe--a case report and molecular detection of specific gene fusions from archival FFPE sample. Clin Neuropathol. 2015;34(5):288–93.

    Article  Google Scholar 

  16. Wang L, Motoi T, Khanin R, Olshen A, Mertens F, Bridge J, Dal Cin P, Antonescu CR, Singer S, Hameed M, et al. Identification of a novel, recurrent HEY1-NCOA2 fusion in mesenchymal chondrosarcoma based on a genome-wide screen of exon-level expression data. Genes Chromosomes Cancer. 2012;51(2):127–39.

    CAS  Article  Google Scholar 

  17. Fritchie KJ, Jin L, Ruano A, Oliveira AM, Rubin BP. Are meningeal hemangiopericytoma and mesenchymal chondrosarcoma the same?: a study of HEY1-NCOA2 fusion. Am J Clin Pathol. 2013;140(5):670–4.

    CAS  Article  Google Scholar 

  18. Luo W, Milash B, Dalley B, Smith R, Zhou H, Dutrow N, Cairns BR, Lessnick SL. Antibody detection of translocations in Ewing sarcoma. EMBO Mol Med. 2012;4(6):453–61.

    Article  Google Scholar 

  19. Hsieh CT, Chiang YH, Tsai WC, Sheu LF, Liu MY. Primary spinal epidural Ewing sarcoma: a case report and review of the literature. Turk J Pediatr. 2008;50(3):282–6.

    PubMed  Google Scholar 

  20. Gopalakrishnan CV, Shrivastava A, Easwer HV, Nair S. Primary Ewing’s sarcoma of the spine presenting as acute paraplegia. J Pediatr Neurosci. 2012;7(1):64–6.

    CAS  Article  Google Scholar 

  21. Dogan S, Lekovic GP, Theodore N, Horn EM, Eschbacher J, Rekate HL. Primary thoracolumbar Ewing's sarcoma presenting as isolated epidural mass. Spine J. 2009;9(1):e9–14.

    Article  Google Scholar 

  22. Barr FG, Womer RB. Molecular diagnosis of Ewing family tumors: too many fusions... ? J Mol Diagn : JMD. 2007;9(4):437–40.

    Article  Google Scholar 

  23. Chang KTE, Goytain A, Tucker T, Karsan A, Lee CH, Nielsen TO, Ng TL. Development and evaluation of a pan-sarcoma fusion gene detection assay using the NanoString nCounter platform. J Mol Diagn : JMD. 2018;20(1):63–77.

    CAS  Article  Google Scholar 

  24. van Doorninck JA, Ji L, Schaub B, Shimada H, Wing MR, Krailo MD, Lessnick SL, Marina N, Triche TJ, Sposto R, et al. Current treatment protocols have eliminated the prognostic advantage of type 1 fusions in Ewing sarcoma: a report from the Children’s oncology group. J Clin Oncol. 2010;28(12):1989–94.

    Article  Google Scholar 

  25. Le Deley MC, Delattre O, Schaefer KL, Burchill SA, Koehler G, Hogendoorn PC, Lion T, Poremba C, Marandet J, Ballet S, et al. Impact of EWS-ETS fusion type on disease progression in Ewing's sarcoma/peripheral primitive neuroectodermal tumor: prospective results from the cooperative euro-E.W.I.N.G. 99 trial. J Clin Oncol. 2010;28(12):1982–8.

    Article  Google Scholar 

  26. Noujaim J, Jones RL, Swansbury J, Gonzalez D, Benson C, Judson I, Fisher C, Thway K. The spectrum of EWSR1-rearranged neoplasms at a tertiary sarcoma Centre; assessing 772 tumour specimens and the value of current ancillary molecular diagnostic modalities. Br J Cancer. 2017;116(5):669–78.

    CAS  Article  Google Scholar 

  27. Newby R, Rowe D, Paterson L, Farquharson MA, MacDuff E, Coupe A, Hale J, Dildey P, Bown N. Cryptic EWSR1-FLI1 fusions in Ewing sarcoma: potential pitfalls in the diagnostic use of fluorescence in situ hybridization probes. Cancer Genet Cytogenet. 2010;200(1):60–4.

    CAS  Article  Google Scholar 

  28. Eastmond DA, Schuler M, Rupa DS. Advantages and limitations of using fluorescence in situ hybridization for the detection of aneuploidy in interphase human cells. Mutat Res. 1995;348(4):153–62.

    CAS  Article  Google Scholar 

  29. Niu X, Chuang JC, Berry GJ, Wakelee HA. Anaplastic lymphoma kinase testing: IHC vs. FISH vs. NGS. Curr Treat Options in Oncol. 2017;18(12):71.

    Article  Google Scholar 

  30. Mitelman F, Johansson B, Mertens F. The impact of translocations and gene fusions on cancer causation. Nat Rev Cancer. 2007;7(4):233–45.

    CAS  Article  Google Scholar 

  31. Groisberg R, Roszik J, Conley A, Patel SR, Subbiah V. The role of next-generation sequencing in sarcomas: evolution from light microscope to molecular microscope. Curr Oncol Rep. 2017;19(12):78.

    Article  Google Scholar 

  32. Nakada S, Minato H, Nojima T. Clinicopathological differences between variants of the NAB2-STAT6 fusion gene in solitary fibrous tumors of the meninges and extra-central nervous system. Brain Tumor Pathol. 2016;33(3):169–74.

    CAS  Article  Google Scholar 

  33. Lee CH, Nucci MR. Endometrial stromal sarcoma--the new genetic paradigm. Histopathology. 2015;67(1):1–19.

    Article  Google Scholar 

  34. Cantile M, Marra L, Franco R, Ascierto P, Liguori G, De Chiara A, Botti G. Molecular detection and targeting of EWSR1 fusion transcripts in soft tissue tumors. Med Oncol. 2013;30(1):412.

    Article  Google Scholar 

Download references


The materials and data analyses used in this study was supported by the VIVA-KKH Paediatric Brain and Solid Tumour Programme.

Availability of data and materials

The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.

Author information

Authors and Affiliations



Conceptualization: SL. Data curation: SL, GT, WT, DL. Formal analysis: CH, HC, NB, KC. Investigation: SL, WY, CH, NB. Methodology: SL, KC, CK. Project administration: SL, LP. Resources: KC, DL, ET, SY. Validation: CH, NB, HC. Writing – original draft: SL. Writing – review & editing: SL, KC. All authors read and approved the final manuscript.

Corresponding author

Correspondence to Sharon Y. Y. Low.

Ethics declarations

Ethics approval and consent to participate

This is a study approved by the hospital ethics board (Study Reference: Singhealth CIRB: 2014/ 2079) protocol for patient enrolment and study of their clinical material. Written, informed consent was obtained by the respective patients and, or their parents/ legal guardians for the study of their clinical material. A copy of the consent is available for review.

Consent for publication

Written informed consent for publication of their clinical details and/or clinical images was obtained by the respective patients and, or their parents/ legal guardians. A copy of the publication consent form is available for review by the Editor of this journal.

Competing interests

The authors declare that they have no competing interests.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (, which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver ( applies to the data made available in this article, unless otherwise stated.

Reprints and Permissions

About this article

Verify currency and authenticity via CrossMark

Cite this article

Low, S.Y.Y., Kuick, C.H., Seow, W.Y. et al. Primary paediatric epidural sarcomas: molecular exploration of three cases. BMC Cancer 19, 182 (2019).

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI:


  • Epidural sarcoma
  • Next-generation sequencing