Transcriptome analysis
Total RNA was extracted from 60 ccRCC samples (49 cases without metastasis, and 11 cases with synchronous metastasis at nephrectomy), and 20 corresponding normal kidney samples using the TRIzol Reagent (Invitrogen®). The tumor samples contained > 70% tumor cells as estimated by microscopy. Gene expression analysis was performed on the Genechip Human Gene 1.0 ST Array (Affymetrix®), according to the manufacturers’ instructions. The expression profiles were analyzed using an unsupervised hierarchical average linkage-clustering algorithm. The analysis was ethically approved at our institution (Radboud University Medical Center, Nijmegen).
Antibodies
The following primary antibodies were used: anti-CAIX monoclonal antibody M75 (HB-11128, ATCC), rabbit anti-NDUFA4L2 (Proteintech®), anti-PHD3 monoclonal antibody (Novus Biologicals®), rabbit anti-MCT4 (Millipore®), rabbit anti-FABP7 polyclonal antibody (produced by a co-author, YO [8]), and a mouse anti-Stat3 monoclonal antibody (Abcam®). Primary antibodies were detected using a horseradish peroxidase (HRP)-conjugated rabbit anti-mouse immunoglobulin antibody) (DAKO®) and HRP-conjugated swine anti-rabbit immunoglobulin antibody (DAKO®) (secondary antibodies).
Immunohistochemistry
For immunohsitochemical analysis, we used the slides of paraffin-embedded ccRCC and normal kidney samples extracted from the same cases used in our transcriptome analysis.
Slides of paraffin-embedded ccRCC samples were deparaffinized in xylene, followed by incubation in a graded series of ethanol (100, 70 and 50%) and re-hydration in PBS. The slides were immersed in 3% H2O2 for 30 min at room temperature to block endogenous peroxidase activity. After a PBS wash, the slides were immersed in 10 mM citrate buffer (pH 6.0) and heated in a microwave oven for 10 min at 100 °C. After cooling to room temperature, the slides were blocked in 20% normal goat serum for 10 min. The tissue slices were then incubated with the mouse anti-CAIX monoclonal M75 antibody (1600 dilution), rabbit anti-NDUFA4L2 polyclonal antibody (12,000 dilution), mouse anti-PHD3 monoclonal antibody (1200 dilution), rabbit anti-MCT4 polyclonal antibody (1200), or the rabbit anti-FABP7 polyclonal antibody (11000) for 90 min at room temperature, washed in PBS, and then incubated with the appropriate secondary antibody for 1 h at room temperature (1100 dilution). After washing with PBS, the slides were incubated in a PowerVision DAB solution (40 μl of Solution A + 40 μl of Solution B + 5 μl of Tween 20 brought up to 1 ml with PBS, ImmunoLogic®) for 10 min at room temperature, washed again in tap water, counterstained with hematoxylin, and mounted in Permount (Fisher Scientific®).
Patients’ characteristics in the cases analyzed by FABP7 immunohistochemical staining
We retrospectively reviewed the clinical data of 40 patients with metastatic ccRCC who had undergone nephrectomy, followed by systemic therapy using either a cytokine, VEGF-TKIs, or mTOR inhibitors in Yamaguchi University Hospital. The analysis was ethically approved at our institution (Yamaguchi University Hospital).
Evaluation of FABP7 expression status in ccRCC specimens
We scored the FABP7 staining index based on the staining intensity (Fig. 2a, low: 1, intermediate: 2, high: 3, and nuclear staining: 4 points) and the number of the cells as calculated by the formula: (staining intensity 1, 2, 3, or 4) × cell counts per 500 cells in each sample of ccRCC specimen. The mean value of the index was 11 in all the cases analyzed. We defined the case with more than mean value of the index as high FABP7 expression case, and also defined the case with less than mean value of the index as low FABP7 expression case.
RNA extraction and real-time quantitative RT-PCR
Total RNA was extracted from the cultured cells using the TRIzol Reagent (Invitrogen®). RNA was used for reverse transcription with SuperScript II RNase Hˉ Reverse Transcriptase (Invitrogen®). The cDNA synthesis was performed using 2 μg of RNA with a mix of reverse transcriptase, 5× first-strand buffer, DTT, dNTPs, and random hexamers.
qRT-PCR was run using a LightCycler 480 Real-Time PCR System (Roche®). The SYBR Green method was used to measure hypoxanthine phosphoribosyltransferase 1 (HPRT), CAIX, MCT4, FABP7 and FABP6 mRNA expression and the TaqMan method to measure HPRT, PHD3-, and NDUFA4L2 mRNA expression levels. The primer sequences were as follows:
-
HPRT
Forward primer sequence: 5’CTCAACTTTAACTGGAAAGAATGTC3’
Reverse primer sequence: 5’TCCTTTTCACCAGCAAGCT3’
Probe sequence: 5’TTGCTTTCCTTGGTCAGGCAGTATAATC3’
-
CAIX
Forward primer sequence: 5’TAAGCAGCTCCACACCCTCT3’
Reverse primer sequence: 5’TCTCATCTGCACAAGGAACG3’
-
MCT4
Forward primer sequence: 5’GCACCCACAAGT TCTCCAGT3’
Reverse primer sequence: 5’CAAAATCAGGGAGGAGGTGA3’
-
PHD3
Forward primer sequence: 5’GAATTGGGATGCCAAGCTACA3’
Reverse primer sequence: 5’TGACCAGAAGAACAGGAGTCTGTC3’
Probe sequence: 5’ATGGGCTCCACATCTGCTATGAATGATTTC3’
-
NDUFA4L2
Forward primer sequence: 5’GACGTCTGCTGGGACAGAAAG3’
Reverse primer sequence: 5’AGTGGAAACTGCAAGGAACTTGTA3’
Probe sequence: 5’CCGGAGCCCTGGAACCGC3’
-
FABP7
Forward primer sequence: 5’CTCAGCACATTCAAGAACACG3’
Reverse primer sequence: 5’CCATCCAGGCTAACAACAGAC3’
-
FABP6
Forward primer sequence: 5’ACTACTCCGGGGGCCACACCAT3’
Reverse primer sequence: 5’GTCTCTTGCTCACGCGCTCATAGG3’
HPRT mRNA expression served as an internal control. All the measurements were repeated at least twice to confirm reproducibility. The expression of the target mRNA was quantified relative to that of the HPRT mRNA and untreated controls were used as a reference according to the model described by Pfaffl [9].
Cell culture
Human ccRCC-derived cell lines (SKRC1, SKRC7, SKRC10, SKRC12, SKRC17, SKRC59, and CaKi1) were cultured in the RPMI 1640 medium supplemented with 10% of fetal calf serum and ʟ-glutamate (Gibco®) in a humidified atmosphere containing 5% of CO2 at 37 °C.
Western blot analysis
Protein expression levels were determined by western blot analysis. In brief, cells were lysed in a buffer consisting of 20 mM Tris-HCl (pH 7.5), 150 mmol/l NaCl, 0.1% SDS, 5 mmol/l EDTA, 1% of Triton X-100 (Sigma-Aldrich®), and 1 tablet of a protease inhibitor cocktail (cOmplete Mini, Roche®) per 10 mL of the buffer. The lysates were centrifuged at 13,200 rpm for 15 min at 4 °C, and the supernatants were collected to determine protein concentration using the BSA protein assay reagent. Total protein (10 or 20 μg) was separated by SDS-PAGE in a 10% gel and transferred to a filter using a semidry blotter. After blocking with 1% skimmed milk powder dissolved in PBS, the blots were incubated with the appropriate primary and secondary antibodies: the rabbit anti-FABP7 polyclonal antibody (1,5000) and mouse anti-Stat3 monoclonal antibody (110000). Detection was performed using the Amersham ECL Plus Western Blotting Detection Reagents kit (Amersham®), and protein expression levels were quantified in the ImageJ software (NIH, USA).
The knockdown with small interfering RNA (siRNA)
A commercially available mixture of 4 single-stranded 19-bp siRNAs (ON-TARGETplus SMARTpool, Invitrogen®) was used to transfect SKRC7 and SKRC10 cells according to the manufacturer’s instructions. The sequences of the siRNAs were 5’CAACGGUAAUUAUCAGUCA3’, 5’GUCAGAACUUUGAUGAGUA3’, 5’GAACACGGAGAUUAGUUUC3’, and 5’GAUGAUAGAAACUGUAAGU3’ for FABP7, 5’UCGGAGGCGUGACCUAUGA3’, 5’CCUCAGAGAUCGUGGGUGA3’, 5’GUGAGAAGAAUUAUGAUGA3’, and 5’GCAAGGAAAGCAACAUACA3’ for FABP6.
The final concentration of siRNA for transfection was 33 nmol/L. A scrambled siRNA served as a negative control (Invitrogen®). Transfection was carried out using Lipofectamine 2000 (Invitrogen®).
Cell viability assay
Cell viability was tested by a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay.
SKRC7 and SKRC10 cells transfected with scrambled siRNA, FABP7 siRNA, or FABP6 siRNA were seeded in triplicate in 96-well plates at 4000 cells per well and cultured at 37 °C and 5% CO2 for up to 7 days. On the day of measurement, 30 μL of MTT Thiazolyl Blue (5 mg/mL: Sigma-Aldrich®) was added into each well, and the cells were incubated for an additional 4 h. Subsequently, 100 μL of DMSO was added, and the plate was shaken for 5 min at room temperature to dissolve the formazan crystals. Finally, optical density (OD) at 595 nm was measured (3550 Microplate Reader, Bio-rad®).
Cell invasion assay
This assay was conducted using a BD BioCoat Matrigel Invasion Chamber (BD-Biosciences®).
SKRC10 cells were harvested 48 h after transfection at 37 °C. The transfected cells were re-suspended in serum-free Dulbecco’s modified Eagle’s medium and then added to the upper chamber at a density of 2 × 105 cells/well. After 24 h of incubation at 37 °C, cells migrating through the membrane were stained. The results are expressed as invading cells quantified at OD 560 nm.
Statistical analysis
Student’s t test was used for statistical analysis using commercially available software (JMP version 4, SAS). A different with a p-value less than 0.05 was considered significant.
