Skip to main content

Advertisement

Table 1 Primers for PCR experiments

From: Expression of TRPC6 channels in human epithelial breast cancer cells

Gene Accession n° Primer Sequence (5-3) Predicted Size, bp
hTRPC3 NM003305 Sense GGAAAAACATTACCTCCACCTTTCA  
   Antisense CTCAGTTGCTTGGCTCTTGTCTTCC 383 pb
hTRPC6 NM 004621 Sense GAACTTAGCAATGAACTGGCAGT 625 pb for TRPC6
   Antisense CATATCATGCCTATTACCCAGGA 277 pb for TRPC6γ
hTRPC7 NM 020389 Sense GTCCGAATGCAAGGAAATCT  
   Antisense TGGGTTGTATTTGGCACCTC 477 pb
hβ-actin NM 001101 Sense CAGAGCAAGAGAGGCATCCT  
   Antisense ACGTACATGGCTGGGGTG 210 pb
hCK19 NM 002276 Sense GATTGCCACCTACCGC  
   Antisense CCATCCCTCTACCCAG 136 pb