Skip to main content
Download PDF
  • Research article
  • Open access
  • Published:

MicroRNA-645, up-regulated in human adencarcinoma of gastric esophageal junction, inhibits apoptosis by targeting tumor suppressor IFIT2

BMC Cancer volume 14, Article number: 633 (2014) Cite this article

Abstract

Background

An increasing body of evidence indicates that miRNAs have a critical role in carcinogenesis and cancer progression; however, the role of miRNAs in the tumorigenesis of adencarcinoma of gastric esophageal junction (AGEJ) remains largely unclear.

Methods

The SGC7901 and BGC-823 gastric cancer cell lines were used. The expressions of miR-645 and IFIT2 (Interferon-induced protein with tetratricopeptide repeats 2) were examined by qRT-PCR, The expressions of IFIT2 was examined by western blotting and immunohistochemistry assay. The cell apoptosis was determined by FACS. MiR-645 inhibitor, mimics and plasmid-IFIT2 transfections were performed to study the loss- and gain-function. Caspase-3/7 activity was examined by caspase-3/7 assay.

Results

In the present study, we have reported an increased expression of miR-645 in AGEJ clinical specimens compared with paired non-cancerous tissues. We also observed a significant miR-645 up-regulation in two gastric cancer (GC) cell lines, SGC7901 and BGC-823, which were used as cell models because there was no available AGEJ cell lines established to date. We found that inhibition of miR-645 could sensitize dramatically SGC7901 and BGC-823 cells to both serum starvation– and chemotherapeutic drug–induced apoptosis by up-regulating IFIT2, a mediator of apoptosis via a mitochondrial pathway, with a potential binding site for miR-645 in its mRNA’s 3′UTR. Further investigation exhibited that IFIT2 expression decreases in SGC7901 and BGC-823 cells and AGEJ tissues. IFIT2 ectopic expression leads to promotion of cell apoptosis, indicating that IFIT2 may function as a suppressor in the development of AGEJ. Furthermore, inhibition of miR-645 induces up-regulation of IFIT2 and increased caspase-3/7 activity compared with control groups.

Conclusions

Our data suggest that miR-645 functions as an oncogene in human AGEJ by, at least partially through, targeting IFIT2.

Peer Review reports

Background

Recent studies have suggested that adencarcinoma of gastric esophageal junction (AGEJ) is distinct from that of distal stomach, with different risk factors, tumor characteristics, and biological behavior [1–4]. Moreover, the incidence of AGEJ has been increasing over the past 30 years, especially in United States and north China [5–9].

microRNAs (miRNAs) are a group of endogenously expressed, non-coding small RNAs, 20–25 nucleotides in length, which are known to negatively regulate gene expression through suppressing translation or decreasing the stability of mRNAs by directly binding to the 3′-untranslated region (3′-UTR) of target mRNAs [10, 11]. Accumulating evidence indicates that miRNAs have important roles in regulating physiological and pathological processes, including development [12], metabolism [13], cell proliferation [14], differentiation [15] and apoptosis [16]. In addition, aberrant post-transcriptional regulation of mRNAs by miRNAs is related with tumorigenesis [17, 18]. The abnormal expression profiles of miRNAs have been reported to be detected in various types of human tumors including lung [19], breast [20], prostate [21], liver [18], colon [22] and gastric cancer [23]. Moreover, some miRNAs can act as oncogenes [24–26] or tumor supressors [27, 28] by regulating the expression of their target genes which have important roles in some key pathways involved in cell cycle progression, apoptosis or proliferation. miRNAs down-regulated in tumour specimens such as miR-22 [29, 30], miR-101 [31, 32], and miR-7 [33, 34] usually function as suppressive miRNAs, while miRNAs upregulated in tumour specimens such as miR-17 [35, 36], and miR-21 [37, 38] usually exert oncogenic roles. These studies suggest that dysregulation of miRNAs is frequently involved in carcinogenesis and cancer progression.

A recent study has indicated that miR-645 may exert the tumor suppressor role in advanced serous ovarian cancer for miR-645 is negatively associated with overall survival of it [39]. In the present study, we found that miR-645 expression was significantly increased in AGEJ clinical specimens compared with paired non-cancerous tissues using microRNA chips. However, the role of miR-645 in the tumorigenesis of AGEJ has not been studied yet. Further study showed that miR-645 was also significantly up-regulated in two gastric cancer (GC) cell lines, SGC7901 and BGC-823, which were used as alternative cell models in the present study. Inhibition of miR-645 in SGC7901 and BGC-823 cells significantly suppressed the apoptosis of SGC7901 and BGC-823 cells in the condition of serum starvation or chemotherapeutic drug by up-regulating IFIT2, a mediator of apoptosis, with a potential binding site for miR-645 in its mRNA’s 3′UTR. The expression pattern of miR-645 and IFIT2 in AGEJ clinical samples were negatively correlated, further suggesting that IFIT2 is a target gene of miR-645. Moreover, inhibition of miR-645 results in increased caspase-3/7 activity, which is activated by IFIT2. In this study, we investigated whether miR-645 is up-regulated in human adencarcinoma of gastric esophageal junction and inhibits apoptosis by targeting tumor suppressor IFIT2.

Methods

Ethics statement

For tissue samples, written informed consent was obtained from patients. The procedures used in this study were approved by the Institutional Review Board of the Henan University of Science and Technology and was conformed to the Helsinki Declaration, and to local legislation.

Cell lines and culture conditions

Gastric cancer cell lines SGC-7901, BGC-823 and immortalized normal gastric epithelial cell line, GES-1 were kindly bestowed by Prof. Daiming Fan. All the cell lines were maintained in our institute according to recommended protocols. Cells were cultured in RPMI-1640 medium (Invitrogen, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (FBS) (Invitrogen, Carlsbad, CA, USA) at 37°C in a 5% CO2 incubator.

Human specimens

All experimental procedures were approved by the Institutional Review Board of the Henan University of Science and Technology. Written informed consent was obtained for all patient samples. Human AGEJ specimens (n = 43) and patient paired non-cancerous specimens were obtained from patients at the first affiliated hospital, Henan University of Science and Technology, with informed consent from each patient.

RNA purification, cDNA synthesis, and quantitative real-time PCR (qRT-PCR)

Total RNA of cultured cells was extracted with TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol and RNAs were stored at −80°C before qRT-PCR analysis. Mature miR-645 expression was detected using a mirVana TM qRT-PCR miRNA Detection Kit (Ambion Inc. Austin, Texas), with U6 as an internal control. IFIT2 expression was detected with primers F: 5′AGCGAAGGTGTGCTTTGAGA 3′, R: 5′GAGGGTCAATGGCGTTCTGA3′ (product length: 125 bp; Tm: 60°C; GC%: F-50%, R-55%; start-end: 643-748 bp) and GAPDH was used as an internal control. PCR products were separated on an ethidium bromide-stained 1.5% agarose gel and visualized with UV.

Cell transfection

The human miR-645 duplex agomir (400 nM), antagomir (400 nM) and negative control were designed and provided by Ribobio (Guangzhou, Guangdong, China). Plasmid-IFIT2 and the negative control plamid were purchased from Ribobio Inc (Guangzhou, Guangdong, China).

miRNA target prediction

To find potential miRNA target genes, TargetScanHuman website (http://www.targetscan.org/) was used, the binding free energy was calculated and biding sites were analyzed using http://bibiserv.techfak.uni-bielefeld.de/rnahybrid website.

Vector constructs and luciferase reporter assay

To construct IFIT2-3′UTR plasmid, a wild-type 3′-UTR fragment of human IFIT2 mRNA (1226–1233 nt, Genbank accession no. NM_001547.4) containing the putative miR-645 binding sequence was amplified by RT-PCR and cloned into the site between Xho I and Not I downstream of the luciferase reporter gene of the psiCHECK™ vector (Promega, USA). A mutant of the single miR-645 binding site (5′- AGCCTAG −3′ to 5′- TCGGATC −3′) in the 3′-UTR of IFIT2 was included by Site-Directed Mutagenesis Kit (SBS Genetech, Beijing, China). Wild and mutant types of pmirGLO-IFIT2-UTR vectors were validated by DNA sequencing.

The nucleotide sequences of primers for IFIT2-3′UTR (WT) clone:

IFIT2XhoIF2: 5′CCGCTCGAG AGAATAGAGATGTGGTGCCCACTAGGCTACTGCTG 3′.

IFIT2NotIR2: 5′ATAAGAATGCGGCCGC TTAAAATGGAATCAGTGACTTTTATTTCTCATAACAGAG 3′.

The nucleotide sequences of primers for IFIT2-3′UTR (MT) clone:

mutIFIT2F2: 5′TTCTAGGTAGATGCTGAATTCGGATCACATCAAAGTTGGTGTGAAC 3′.

mutIFIT2R2: 5′GTTCACACCAACTTTGATGTGATCCGAATTCAAGEJTCTACCTAGAA 3′.

Cells were transfected with the miR-645 mimics, NC and pmirGLO plasmid in 24-well plates using lipofectamine™ 2000 (Invitrogen) according to the instructions. 48 h later, cells were harvested and analyzed for luciferase activity using the Dual-Luciferase Reporter Assay System (Promega, USA) and detected by the GloMaxTM 20/20 detection system (E5331, Promega).

caspase-3/7 assay

The activity of caspase-3 and caspase-7 was detected in 96-well format (2 × 103 cells/well) using the Caspase-Glo 3/7 Assay (Promega) according to the instructions. 100 μL Caspase-Glo 3/7 reagent were supplemented into each well and then incubated at room temperature for 1 h follwong the luminescence was detected using the M200 microplate fluorescence reader (Tecan). The background luminescence associated with cell culture and assay reagent (blank reaction) was subtracted from experimental value.

MTT assay

Cells were transfected with 100 nM miR-645 inhibitor (Genepharma, Shanghai, China), mimics (Ribobio Inc., Guangzhou, Guangdong, China) or 100 nM plamid-IFIT2 (Ribobio Inc., China). Twenty-four later, cells were seeded in 96-well plates (2 × 103/well). The viability of cells was examined by MTT (3–2, 5-diphenyl tetrazolium bromide) assay (Sigma, USA) according to instructions at designated time.

Western blotting

Total protein from cultured cells were lysed by Lysis Buffer containing PMSF on ice. Then protein were electrophoresed through 12% SDS polyacrylamide gels and were then transferred to a PVDF membrane (Millipore). Membranes were blocked with 5% non-fat milk powder at room temperature for 1 h and incubated overnight with primary antibodies. Membranes were incubated with secondary antibodies labeled with HRP for 1 h at room temperature after three 10 min washes in TBS-T (triethanolaminebuffered saline solution with Tween). Finally, the signals were detected using ECL kit (Pierce Biotech., Rockford, IL, USA) and the membranes were scanned and analyzed using a Bio-Rad ChemiDoc XRS + imaging system with imaging software (version quantity 1). The protein expression was normalized to an endogenous reference (Tubulin) and relative to the control. The Spectra multicolor broad-range protein ladder (Fermentas) was used as molecular marker. All the antibodies used in western blot assay are listed in Additional file 1: Table S1.

Immunohistochemistry and immunohistochemical scoring

Paraffin sections, 4-μm in thickness, were baked for 2 h at 65°C and deparaffinized. Antigen retrieval was performed using citrate sodium buffer (PH 7.2) at 95°C for 15 minutes and then slides were cooled at room temperature for 30 minutes. After being treated with 3% hydrogen peroxide for 15 minutes to block the endogenous peroxidase, the sections were treated with normal goat serum confining liquid for 30 minutes to reduce non-specific binding and then rabbit polyclonal anti-IFIT2 (1:500, HPA003408, Sigma-Aldrich. Shanghai, China) was incubated the sections for 12 h at 4°C. After rewarming for 1 h and washing for 5 times, sections were incubated with secondary antibody for 30 minutes at room temperature. Diaminobenzidine (DAB) was used for color reactions. Subsequent immunohistochemical staining was scored as previously described [40].

Statistical analysis

Data were expressed as Mean ± SD of three independent experiments. For statistical tests, SPSS statistical software package, version17.0 (SPSS, Chicago, IL, USA) was used. The student’s t-test, the one-way ANOVA and two-way ANOVA test were performed for relative band density of western blotting and MTT OD values. The correlation between miR-645 and IFIT2 was analyzed with Spearman rank correlation. P values <0.05 were considered statistically significant.

Results

Expressions of miR-645 are up-regulated in AGEJ clinical samples

To assess the role of miR-645 in the tumorigenesis of AGEJ, we first used qRT - PCR method to measure miR-645 expression of 43 human AGEJ clinical tissues, and found that miR-645 was significantly up-regulated in AGEJ clinical tissues compared with patient paired gastric cardiac non-cancerous tissues (Figure 1A). To gain further insights into the observation mentioned above, we examined the relationship between miR-645 expression and patients clinical parameters. Analysis showed that miR-645 expression was irrelevant with age, sex, tumor differentiation, lymphnode metastasis and TNM stage (Table 1: The relationship between clinical parameters and miR-645 expression in primary gastric cardia adenocarcinoma), but was in a positive correlation with the tumor size, namely, tumor size greater than or equal to 5 cm group showed significant increased miR-645 expression compared with tumor size less than 5 cm group (Figure 1B & Table 1, t-test, *P = 0.045).

Figure 1
figure 1

Expressions of miR-645 are up-regulated in AGEJ clinical samples. A. expression of miR-645 in 43 human AGEJ clinical samples relative to the adjacent paired normal human gastric cardiac non-cancerous tissues, was measured by quantitative RT-PCR (The values indicate the mean ± SEM, n = 3, t-test,* p < 0.05, ** p < 0.01, *** p < 0.001). B. comparison of relative expression of miR-645 in human AGEJ clinical samples of different tumor size. (Two-tailed t-test,* p < 0.05).

Full size image
Table 1 The relationship between clinical parameters and miR-645 expression in primary gastric cardia adenocarcinoma
Full size table

Depletion of miR-645 promotes apoptosis of gastric cancer cells

To investigate the role of miR-645 in the phenotypic characteristics of AGEJ progression, we used two gastric cancer (GC) cell lines, SGC7901 and BGC-823 as cell models. qRT-PCR results showed that miR-645 expression was significantly up-regulated compared with immortalized GC cell line, GES-1 (Additional file 2: Figure S1, P < 0.001).

SGC7901 and BGC-823 cells were transiently transfected with mature miR-645 mimics, inhibitor, mock transfected, or miR-NC. As shown in Figure 2A and D, quantitative RT-PCR results show that expression of miR- 645 mimics or inhibitors significantly up-regulate or down-regulate the expression level of miR-645, respectively, in SGC7901 and BGC-823 cells from the first to fifth day post transfection (Figure 2A, P < 0.001; Figure 2D, P < 0.001) compared to NC and mock controls.

Figure 2
figure 2

Depletion of miR-645 promotes apoptosis of gastric cancer (GC) cells. A &D. The level of miR-645 was measured by quantitative PCR at designated time (One-way ANOVA analysis, the values indicate the mean ± SD, Figure 2 A, F =426.588, P < 0.001; Figure 2 D, F = 685.026, P < 0.001). B &E. GC cells transfected with miR-645 mimics and inhibitor subjected to MTT assay daily for 6 days (Two-way ANOVA analysis, Figure 2 B, F = 52.602, p < 0.001; Figure 2 E, F = 42.847, p < 0.001). C &F. GC cells cells transfected with miR-645 mimics and inhibitor were collected for FACS analysis after 72 h (The values indicate the mean ± SD, n = 3, One-way ANOVA analysis, Figure 2 C-a, F = 121.600, p <0.001; Figure 2 C-b, F = 250.400, p <0.001; Figure F-a, F = 194.815, p <0.001; Figure 2 F-b, F =412.741, p <0.001).

Full size image

SGC7901 and BGC-823 cells transfected with miR-645 inhibitors and mimics showed significantly lower and higher levels of cell proliferation, respectively, comparision with the NC or mock groups in the presence of ADR (0.2 μg/mL) as determined by MTT assay (Figure 2B, P < 0.001; Figure 2E, P < 0.001).

Anniex Vapoptosis assay exhibited significant increased and decreased apoptosis rates of miR-645 depletion and ectopic expression groups compared with NC groups in the serum-free condition or in the presence of anticancer drug, adriamycin (ADR) (Figure 2C a-b, P < 0.001; Figure 2 F a-b, P < 0.001).

IFIT2 is a target of miR-645

Previous data suggest that miR-645 might be an oncogene of advanced serous ovarian cancer. Thus we further searched for the potential targets of miR-645 by algorithm of Target Scan Human. Among them, IFIT2, a tumor suppressor, was found to have putative miR-645 binding sites within its 3′UTR (Figure 3A). Then we performed luciferase reporter assay using SGC7901 and BGC-823 cells to verify whether IFIT2 was a direct target of miR-645. Wild-type and mutant IFIT2-3′UTR containing the putative binding site of miR-645 were cloned into psiCHECK-2 vector downstream from luciferase gene (Additional file 3: Figure S2). Introduction of miR-645 reduced the lucirferase activity from the IFIT2 3′UTR reporter vector significantly (Figure 3B, P < 0.001; Figure 3C, P < 0.001), but did not affect the lucirferase activity from the mutant IFIT2 3′UTR reporter vector, supporting the direct interaction of miR-645 with IFIT2. These results further suggest that miR-645 may suppress the IFIT2 expression by targeting the 3′-UTR of IFIT2 mRNA.

Figure 3
figure 3

Validating the predicted binding sites between miR-645 and IFIT2. A. The schematic diagram shows the construct of Luc-IFIT2 3′UTR and Luc-IFIT2 3′Mut UTR. Both Luc-IFIT2 3′UTR and Luc-IFIT2 3′Mut UTR were cloned into a pmirGLO plasmid downstream of the firefly luciferase coding region between the PmeI and XbaI sites. B&C. SGC7901 cells (B) or BGC-823 cells (C) were co-transfected with the psiCHECK-2 constructs containing either IFIT2 3′UTR or IFIT2 3′Mut UTR and either the miR-645 inhibitor or the miR-645 mimics for 48 h. Values indicate the relative luciferase activity after normalization to Renilla luciferase activity (The values indicate the mean ± SD, n = 3, One-way ANOVA analysis, Figure 3 B, F = 283.244, Figure 3 C, F = 143.313. ***p < 0.001).

Full size image

Expression of miR-645 and IFIT2 are negatively related in AGEJ clinical samples

To further assess the relation between miR-645 and IFIT2, we examined the IFIT2 expression in 43 AGEJ clinical samples using qRT-PCR. It was found AGEJ tissues had a remarkable lower expression level of IFIT2 than the paired non-cancerous tissues (Figure 4A), and IFIT2 expression was inversely correlated with the tumor size (Figure 4B, P = 0.0304). Namely, tumor size greater than or equal to 5 cm group showed significant down-regulated IFIT2 expression compared with tumor size less than 5 cm group. To validate the data, we subsequently measured protein expression of IFIT2 using western blotting (Figure 4C a-b), and the results showed a similar pattern to the observations found by qRT-PCR. Immunohistochemistry assay exhibited a significant decreased expression of IFIT2 in AGEJ tissues paired non-cancerous tissues (Figure 4D a-b, P < 0.001). Then we analyzed the relationship between miR-645 and IFIT2 expression and found that IFIT2 expression level was negatively correlated with that of miR-645(Figure 4E, P < 0.01). Moreover, SGC7901 (Figure 4F a) and BGC-823 (Figure 4F b) cells transfected with miR-645 inhibitor have significantly increased IFIT2 expression at the protein and mRNA levels compared to mock and NC groups (Figure 4F a-b, P < 0.01). Our findings indicate that miR-645 may directly regulate the expression of IFIT2.

Figure 4
figure 4

Expression of miR-645 and IFIT2 negatively correlate in AGEJ clinical samples and IFIT2 was down-regulated in AGEJ tissues compared with paired non-cancerous tissues. A. Expression of IFIT2 and miR-645 in AGEJ clinical samples were analyzed by quantitative PCR. B. comparison of relative expression of IFIT2 in human AGEJ clinical samples of different tumor size. (t-test, *p < 0.05). C. Expression of IFIT2 examined by western blotting (a, b: the values indicate the mean ± SD, normalized to tubulin, n = 3, t-test, ***p <0.001) D. a. Representative images shown are positive immunohistochemical staining of IFIT2 in human AGEJ specimens and matched adjacent normal tissues (magnification 200×). b. Staining scores of IFIT2 (t-test, ***p <0.001). E. Scatter plots showing the negative linear correlation between the mRNA expression of IFIT2 and that of miR-645 in 43 AGEJ clinical samples. F. IFIT2 and IFIT2 expression measured by western blotting in SGC7901(a) and BGC-823 cells (b). (The values indicate the mean ± SD, n = 3, One-way ANOVA analysis, ***p < 0.001).

Full size image

IFIT2 mediates the function of miR-645 by promoting SGC7901 and BGC-823 cells apoptosis

To confirm that the induction of cell apoptosis in SGC7901 and BGC-823 cells by miR-645 was mediated by targeting IFIT2, we performed IFIT2 plasmid transfection in SGC7901 (Figure 5A) and BGC-823 (Figure 5B) cells to up-regulate the expression of IFIT2. Western blotting and quantitative PCR showed that up-regulation of IFIT2 by IFIT2 plasmid transfection could be decreased significantly by miR-645 mimics. MTT assay showed that cells transfected with plasmid-IFIT2 proliferation was suppressed, however, cells transfected with miR-645 mimics proliferation increased significantly compared with plasmid-control and plasmid-IFIT2 + miR-645 groups (Figure 5C a-b, P < 0.001). Furthermore, introduction of IFIT2 promoted apoptosis of SGC7901 and BGC-823 cells and miR-645 mimics reduced apoptosis of cells induced by IFIT2 up-regulation compared with NC group in the presence of ADR (Figure 5E-F, P < 0.001). Our findings suggested that IFIT2 mediated the function of miR-645 in inhibiting SGC7901 and BGC-823 cells proliferation and inducing cell apoptosis.

Figure 5
figure 5

IFIT2 mediates the function of miR-645 by promoting GC cell apoptosis. A &B. Expression of IFIT2 examined by western blotting (A: SGC7901; B, BGC-823. a, normalized to tubulin, the values indicate the mean ± SD, One-Way ANOVA analysis, for SGC7901, F = 189.307, for BGC-823, F = 85.374; b, The values indicate the mean ± SD, One-Way ANOVA analysis, for SGC7901, F = 85.374, for BGC-823, F = 219.921; ***p < 0.001). C. SGC7901 (a) and BGC-823 (b) cells subjected to MTT assay daily for 6 days (the values indicate the mean ± SD, Two-way ANOVA analysis, for SGC7901, F = 13.768, for BGC-823, F = 16.409, ***p <0.001). D &E. SGC7901 (D) and BGC-823 (E) cells were collected for FACS analysis after 72 h in the presence of ADR (0.05 μg/mL) (the values indicate the mean ± SD, n = 3, One-Way ANOVA analysis; for SGC7901, F = 361.749, for BGC-823, F = 229.952; ***p < 0.001).

Full size image

Depletion and up-regulation of miR-645 altered the caspase-3/7 activity

IFIT2 has been reported to be a tumor suppressor via mediating cell apoptosis through activating caspase-3/7 activity. Caspase-Glo 3/7 assay showed that miR-645 depletion significantly up-regulated, while miR-645 overexpression down- regulated the caspase-3/7 activity compared with mock and NC groups in the presence of ADR (0.2 μg/mL) (Figure 6A and B, P < 0.001) or the serum starvation condition (Figure 6C and D, P < 0.001). These results combined with observations stated above suggested that miR-645, up-regulated in human AGEJ tissues, inhibited cell apoptosis and promotes tumorigenicity via suppressing caspase-3/7 activity by targeting IFIT2.

Figure 6
figure 6

Caspase-3/7 activity. Anti-apoptotic ability of SGC7901 cells and BGC-823 cells after exposure to ADR (0.2 μg/mL) or serum starvation was evaluated by caspases-3/7 activity. A &C, SGC7901 cells; B &D, BGC-823 cells. (the values indicate the mean ± SD, n = 3, One-Way ANOVA analysis; for A, F = 183.930, for B, F = 1093.797; for C, F = 1861.50, for D, F = 1483.604, ***p < 0.001).

Full size image

Discussion and conclusions

Although accumulating evidence have shown that miRNAs deregulation is involved with tumor carcinogenesis, progression, migration and invasion [41], metastasis [42, 43] and multidrug resistance [44–46]. Little is known about the roles of miRNAs in the development of adencarcinoma of gastric esophageal junction (AGEJ). Here, we showed that that miR-645 expression was significantly increased in AGEJ clinical specimens compared with paired non-cancerous tissues and was significantly up-regulated in two gastric cancer (GC) cell lines, SGC7901 and BGC-823, which were used alternative cell models because no available AGEJ cell lines were established to date. Inhibition of miR-645 in SGC7901 and BGC-823 cells significantly induced apoptosis of SGC7901 and BGC-823 cells in the condition of serum starvation or chemotherapeutic drug by up-regulating IFIT2, a mediator of apoptosis, with a potential binding site for miR-645 in its mRNA’s 3′UTR. The expression pattern of miR-645 and IFIT2 in SGC7901 and BGC-823 cells and clinical samples were negatively correlated, further suggesting that IFIT2 is a target gene of miR-645. Moreover, inhibition of miR-645 results in increased caspase-3/7 activity, which is activated by IFIT2. All these findings suggest a fundamental role of miR-645 in carcinogenesis, especially in the development of AGEJ.

Too little apoptosis is one crucial cause of carcinogenesis because malignant cells death are reduced remarkably [47, 48], resulting in malignant transformation of the affected cells, tumour metastasis and multidrug resistance of cancer cells. Hence, apoptosis is of great importance in the treatment of cancer and is a popular target of many treatment strategies. In this study, we showed that miR-645 impaired cancer cells to serum deprivation–induced apoptosis, whereas the depletion of miR-645 antagonized this effect of miR-645, suggesting that miR-645 may play a crucial role in the adaptation of cancer cells to low nutrition. Increasing numbers of miRNAs have been implicated in the cancer cell apoptosis. On the one hand, microRNAs might function as tumor suppressor via inducing apoptosis, i.e. miR-421, which induces cell proliferation and apoptosis resistance in human nasopharyngeal carcinoma via down-regulation of FOXO4 [49]; miR-149, which induces apoptosis by inhibiting Akt1 and E2F1 in human cancer cells [50] and miRNA-31, which induces apoptosis in human neuroblastoma cells [51]. On the other hand, microRNAs might function as oncogenes by suppressing apoptosis, i.e. miR-24, which inhibits apoptosis and represses Bim in mouse cardiomyocytes [52]; miR-886-5p, which inhibits apoptosis by down-regulating Bax expression in human cervical carcinoma cells [53], and miR-183, which inhibits TGF-β1-induced apoptosis by downregulation of PDCD4 expression in human hepatocellular carcinoma cells [54].

ISGs, IFN stimulated genes, refer to genes that are tanscribed by IFNs induction. Among them, 4 can play important roles that affect both the inhibition of viral replication and the inhibition of cellular proliferation [55, 56]. These genes can inhibit viral replication by sacrificing the cell through promoting apoptosis and suppress the cancer progression via inhibiting the malignantly transformed cell survival for the benefit of the host [57]. The ISG54 gene codes for a protein of 54 kDa (472 aa) with tetratricopeptide repeats (TPR) and has also been designated IFN-induced protein with tetratricopeptide repeats 2(IFIT2) [58–60]. It is one of four related human ISGs with characteristic TPR motifs. ISG54 (IFIT2) functions as a mediator of apoptosis [60]. In our study, we observed a significant down-regulation of IFIT2 in AGEJ tissues compared with paired non-cancerous tissues, moreover, bioinformatics analysis and luciferase reporter assay indicated that IFIT2 is one target of miR-645. Hence, we assume that over-expression of miR-645 might lead to down-regulation of IFIT2 and in turn the resistance of cells to apoptosis, resulting in AGEJ progression.

Reports have shown that the activation of caspase-3, a key mediator of the execution phase of apoptosis, was clearly apparent in cells expressing ISG54. Pathways leading to caspase activation and apoptosis are often designated as either extrinsic or intrinsic [61]. The extrinsic pathway initiates outside the cell by transmembrane death receptors and the subsequent activation of caspases [61]. The intrinsic pathway, also called the mitochondrial pathway, is dependent on pro-apoptotic proteins such as Bax or Bak that induce mitochondrial outer membrane permeability, release of apoptotic molecules, and activation of caspases [62]. In the present study, we examined the capase-3/7 activity following miR-645 depletion and IFIT2 expression treatment to find that miR-645 expression down-regulation led to up-regulation of IFIT2 and increased capase-3/7 activity, suggesting the role of miR-645 promoting cancer progression via suppressing transformed cell apoptosis through inhibiting IFIT2 expression and capase-3/7 activity.

In summary, our data indicate that miR-645 may function as an oncogene in tumorigenicity of adencarcinoma of gastric esophageal junction and has an important role in inhibiting IFIT2, hence, the up-regulation of miR-645 inhibits the AGEJ cells apoptosis. Moreover, our results showed that IFIT2 may act as a tumor suppressor in the development of AGEJ. However, owing to the fact that each miRNA may regulate many target genes which can affect carcinogenesis in different ways, more studies are needed to investigate other miR-645 targets which may have critical roles in AGEJ tumorigenesis. The present study also provides novel insights into the role of miR-645 in human AGEJ and indicates that miR-645 may serve as a therapeutic target of AGEJ.

Abbreviations

miRNA:

microRNA

AGEJ:

adencarcinoma of gastric esophageal junction

GC:

gastric cancer.

References

  1. Vaughan TL, Davis S, Kristal A, Thomas DB: Obesity, alcohol, and tobacco as risk factors for cancers of the esophagus and gastric cardia: adenocarcinoma versus squamous cell carcinoma. Cancer Epidemiol Biomark Prev. 1995, 4 (2): 85-92.

    CAS  Google Scholar 

  2. Chow W-H, Blot WJ, Vaughan TL, Risch HA, Gammon MD, Stanford JL, Dubrow R, Schoenberg JB, Mayne ST, Farrow DC: Body mass index and risk of adenocarcinomas of the esophagus and gastric cardia. J Natl Cancer Inst. 1998, 90 (2): 150-155. 10.1093/jnci/90.2.150.

    Article  CAS  PubMed  Google Scholar 

  3. Kubo A, Corley DA: Body mass index and adenocarcinomas of the esophagus or gastric cardia: a systematic review and meta-analysis. Cancer Epidemiol Biomark Prev. 2006, 15 (5): 872-878. 10.1158/1055-9965.EPI-05-0860.

    Article  Google Scholar 

  4. Islami F, Sheikhattari P, Ren J, Kamangar F: Gastric atrophy and risk of oesophageal cancer and gastric cardia adenocarcinoma—a systematic review and meta-analysis. Ann Oncol. 2011, 22 (4): 754-760. 10.1093/annonc/mdq411.

    Article  CAS  PubMed  Google Scholar 

  5. Devesa SS, Blot WJ, Fraumeni JF: Changing patterns in the incidence of esophageal and gastric carcinoma in the United States. Cancer. 1998, 83 (10): 2049-2053. 10.1002/(SICI)1097-0142(19981115)83:10<2049::AID-CNCR1>3.0.CO;2-2.

    Article  CAS  PubMed  Google Scholar 

  6. Powell J, McConkey C: Increasing incidence of adenocarcinoma of the gastric cardia and adjacent sites. Br J Cancer. 1990, 62 (3): 440-10.1038/bjc.1990.314.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  7. Lagergren J, Bergström R, Nyrén O: Association between body mass and adenocarcinoma of the esophagus and gastric cardia. Ann Intern Med. 1999, 130 (11): 883-890. 10.7326/0003-4819-130-11-199906010-00003.

    Article  CAS  PubMed  Google Scholar 

  8. Gammon MD, Ahsan H, Schoenberg JB, West AB, Rotterdam H, Niwa S, Blot WJ, Risch HA, Dubrow R, Mayne ST: Tobacco, alcohol, and socioeconomic status and adenocarcinomas of the esophagus and gastric cardia. J Natl Cancer Inst. 1997, 89 (17): 1277-1284. 10.1093/jnci/89.17.1277.

    Article  CAS  PubMed  Google Scholar 

  9. Turati F, Tramacere I, La Vecchia C, Negri E: A meta-analysis of body mass index and esophageal and gastric cardia adenocarcinoma. Ann Oncol. 2013, 24 (3): 609-617. 10.1093/annonc/mds244.

    Article  CAS  PubMed  Google Scholar 

  10. Griffiths-Jones S, Grocock RJ, Van Dongen S, Bateman A, Enright AJ: miRBase: microRNA sequences, targets and gene nomenclature. Nucleic Acids Res. 2006, 34 (suppl 1): D140-D144.

    Article  CAS  PubMed  Google Scholar 

  11. Krek A, Grün D, Poy MN, Wolf R, Rosenberg L, Epstein EJ, MacMenamin P, da Piedade I, Gunsalus KC, Stoffel M: Combinatorial microRNA target predictions. Nat Genet. 2005, 37 (5): 495-500. 10.1038/ng1536.

    Article  CAS  PubMed  Google Scholar 

  12. Wienholds E, Kloosterman WP, Miska E, Alvarez-Saavedra E, Berezikov E, de Bruijn E, Horvitz HR, Kauppinen S, Plasterk RH: MicroRNA expression in zebrafish embryonic development. Science. 2005, 309 (5732): 310-311. 10.1126/science.1114519.

    Article  CAS  PubMed  Google Scholar 

  13. Xu P, Vernooy SY, Guo M, Hay BA: The Drosophila MicroRNA Mir-14 Suppresses Cell Death and Is Required for Normal Fat Metabolism. Curr Biol. 2003, 13 (9): 790-795. 10.1016/S0960-9822(03)00250-1.

    Article  CAS  PubMed  Google Scholar 

  14. Brennecke J, Hipfner DR, Stark A, Russell RB, Cohen SM: < i > bantam</i > Encodes a Developmentally Regulated microRNA that Controls Cell Proliferation and Regulates the Proapoptotic Gene < i > hid</i > in < i > Drosophila</i>. Cell. 2003, 113 (1): 25-36. 10.1016/S0092-8674(03)00231-9.

    Article  CAS  PubMed  Google Scholar 

  15. Chen J-F, Mandel EM, Thomson JM, Wu Q, Callis TE, Hammond SM, Conlon FL, Wang D-Z: The role of microRNA-1 and microRNA-133 in skeletal muscle proliferation and differentiation. Nat Genet. 2005, 38 (2): 228-233.

    Article  PubMed  PubMed Central  Google Scholar 

  16. Cheng AM, Byrom MW, Shelton J, Ford LP: Antisense inhibition of human miRNAs and indications for an involvement of miRNA in cell growth and apoptosis. Nucleic Acids Res. 2005, 33 (4): 1290-1297. 10.1093/nar/gki200.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  17. Kumar MS, Lu J, Mercer KL, Golub TR, Jacks T: Impaired microRNA processing enhances cellular transformation and tumorigenesis. Nat Genet. 2007, 39 (5): 673-677. 10.1038/ng2003.

    Article  CAS  PubMed  Google Scholar 

  18. Kota J, Chivukula RR, O’Donnell KA, Wentzel EA, Montgomery CL, Hwang H-W, Chang T-C, Vivekanandan P, Torbenson M, Clark KR: Therapeutic microRNA delivery suppresses tumorigenesis in a murine liver cancer model. Cell. 2009, 137 (6): 1005-1017. 10.1016/j.cell.2009.04.021.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  19. Garofalo M, Romano G, Di Leva G, Nuovo G, Jeon Y-J, Ngankeu A, Sun J, Lovat F, Alder H, Condorelli G: EGFR and MET receptor tyrosine kinase-altered microRNA expression induces tumorigenesis and gefitinib resistance in lung cancers. Nat Med. 2011, 18 (1): 74-82.

    PubMed  PubMed Central  Google Scholar 

  20. Volinia S, Galasso M, Sana ME, Wise TF, Palatini J, Huebner K, Croce CM: Breast cancer signatures for invasiveness and prognosis defined by deep sequencing of microRNA. Proc Natl Acad Sci. 2012, 109 (8): 3024-3029. 10.1073/pnas.1200010109.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  21. Liu C, Kelnar K, Liu B, Chen X, Calhoun-Davis T, Li H, Patrawala L, Yan H, Jeter C, Honorio S: The microRNA miR-34a inhibits prostate cancer stem cells and metastasis by directly repressing CD44. Nat Med. 2011, 17 (2): 211-215. 10.1038/nm.2284.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  22. Link A, Balaguer F, Shen Y, Nagasaka T, Lozano JJ, Boland CR, Goel A: Fecal MicroRNAs as novel biomarkers for colon cancer screening. Cancer Epidemiol Biomark Prev. 2010, 19 (7): 1766-1774. 10.1158/1055-9965.EPI-10-0027.

    Article  CAS  Google Scholar 

  23. Ueda T, Volinia S, Okumura H, Shimizu M, Taccioli C, Rossi S, Alder H, Liu C-g, Oue N, Yasui W: Relation between microRNA expression and progression and prognosis of gastric cancer: a microRNA expression analysis. Lancet Oncol. 2010, 11 (2): 136-146. 10.1016/S1470-2045(09)70343-2.

    Article  CAS  PubMed  Google Scholar 

  24. Liu X, Sempere LF, Ouyang H, Memoli VA, Andrew AS, Luo Y, Demidenko E, Korc M, Shi W, Preis M: MicroRNA-31 functions as an oncogenic microRNA in mouse and human lung cancer cells by repressing specific tumor suppressors. J Clin Invest. 2010, 120 (4): 1298-10.1172/JCI39566.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  25. Poliseno L, Salmena L, Riccardi L, Fornari A, Song MS, Hobbs RM, Sportoletti P, Varmeh S, Egia A, Fedele G: Identification of the miR-106b ~ 25 microRNA cluster as a proto-oncogenic PTEN-targeting intron that cooperates with its host gene MCM7 in transformation. Sci Signal. 2010, 3 (117): ra29-

    Article  PubMed  PubMed Central  Google Scholar 

  26. Liu T, Tang H, Lang Y, Liu M, Li X: MicroRNA-27a functions as an oncogene in gastric adenocarcinoma by targeting prohibitin. Cancer Lett. 2009, 273 (2): 233-242. 10.1016/j.canlet.2008.08.003.

    Article  CAS  PubMed  Google Scholar 

  27. Wiggins JF, Ruffino L, Kelnar K, Omotola M, Patrawala L, Brown D, Bader AG: Development of a lung cancer therapeutic based on the tumor suppressor microRNA-34. Cancer Res. 2010, 70 (14): 5923-5930. 10.1158/0008-5472.CAN-10-0655.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  28. Mavrakis KJ, Van Der Meulen J, Wolfe AL, Liu X, Mets E, Taghon T, Khan AA, Setty M, Rondou P, Vandenberghe P: A cooperative microRNA-tumor suppressor gene network in acute T-cell lymphoblastic leukemia (T-ALL). Nat Genet. 2011, 43 (7): 673-678. 10.1038/ng.858.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  29. Tsuchiya N, Izumiya M, Ogata-Kawata H, Okamoto K, Fujiwara Y, Nakai M, Okabe A, Schetter AJ, Bowman ED, Midorikawa Y: Tumor suppressor miR-22 determines p53-dependent cellular fate through post-transcriptional regulation of p21. Cancer Res. 2011, 71 (13): 4628-4639. 10.1158/0008-5472.CAN-10-2475.

    Article  CAS  PubMed  Google Scholar 

  30. Wu L-W: Abstract A16: MiR-22 down-regulation via epigenetic control in oral cancer cells. Cancer Res. 2012, 72 (2 Supplement): A16-A16. 10.1158/1538-7445.NONRNA12-A16.

    Article  CAS  Google Scholar 

  31. Strillacci A, Griffoni C, Sansone P, Paterini P, Piazzi G, Lazzarini G, Spisni E, Pantaleo MA, Biasco G, Tomasi V: MiR-101 downregulation is involved in cyclooxygenase-2 overexpression in human colon cancer cells. Exp Cell Res. 2009, 315 (8): 1439-1447. 10.1016/j.yexcr.2008.12.010.

    Article  CAS  PubMed  Google Scholar 

  32. Smits M, Nilsson J, Mir SE, van der Stoop PM, Hulleman E, Niers JM, de Witt Hamer PC, Marquez VE, Cloos J, Krichevsky AM: miR-101 is down-regulated in glioblastoma resulting in EZH2-induced proliferation, migration, and angiogenesis. Oncotarget. 2010, 1 (8): 710-

    Article  PubMed  Google Scholar 

  33. Kong D, Piao Y-S, Yamashita S, Oshima H, Oguma K, Fushida S, Fujimura T, Minamoto T, Seno H, Yamada Y: Inflammation-induced repression of tumor suppressor miR-7 in gastric tumor cells. Oncogene. 2011, 31 (35): 3949-3960.

    Article  PubMed  Google Scholar 

  34. Okuda H, Xing F, Pandey PR, Sharma S, Watabe M, Pai SK, Mo Y-Y, Iiizumi-Gairani M, Hirota S, Liu Y: miR-7 suppresses brain metastasis of breast cancer stem-like cells by modulating KLF4. Cancer Res. 2013, 73 (4): 1434-1444. 10.1158/0008-5472.CAN-12-2037.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  35. Yang F, Yin Y, Wang F, Wang Y, Zhang L, Tang Y, Sun S: miR‒17‒5p Promotes migration of human hepatocellular carcinoma cells through the p38 mitogen‒activated protein kinase‒heat shock protein 27 pathway. Hepatology. 2010, 51 (5): 1614-1623. 10.1002/hep.23566.

    Article  CAS  PubMed  Google Scholar 

  36. Yu J, Ohuchida K, Mizumoto K, Fujita H, Nakata K, Tanaka M: MicroRNA miR-17-5p is overexpressed in pancreatic cancer, associated with a poor prognosis, and involved in cancer cell proliferation and invasion. Cancer Biol Ther. 2010, 10 (8): 748-757. 10.4161/cbt.10.8.13083.

    Article  CAS  PubMed  Google Scholar 

  37. Gao W, Shen H, Liu L, Xu J, Xu J, Shu Y: MiR-21 overexpression in human primary squamous cell lung carcinoma is associated with poor patient prognosis. J Cancer Res Clin Oncol. 2011, 137 (4): 557-566. 10.1007/s00432-010-0918-4.

    Article  CAS  PubMed  Google Scholar 

  38. Seike M, Goto A, Okano T, Bowman ED, Schetter AJ, Horikawa I, Mathe EA, Jen J, Yang P, Sugimura H: MiR-21 is an EGFR-regulated anti-apoptotic factor in lung cancer in never-smokers. Proc Natl Acad Sci. 2009, 106 (29): 12085-12090. 10.1073/pnas.0905234106.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  39. Taylor DD, Gercel-Taylor C: MicroRNA signatures of tumor-derived exosomes as diagnostic biomarkers of ovarian cancer. Gynecol Oncol. 2008, 110 (1): 13-21. 10.1016/j.ygyno.2008.04.033.

    Article  CAS  PubMed  Google Scholar 

  40. Pirker R, Pereira JR, von Pawel J, Krzakowski M, Ramlau R, Park K, de Marinis F, Eberhardt WE, Paz-Ares L, Störkel S: EGFR expression as a predictor of survival for first-line chemotherapy plus cetuximab in patients with advanced non-small-cell lung cancer: analysis of data from the phase 3 FLEX study. Lancet Oncol. 2012, 13 (1): 33-42. 10.1016/S1470-2045(11)70318-7.

    Article  CAS  PubMed  Google Scholar 

  41. Xia H, Qi Y, Ng SS, Chen X, Li D, Chen S, Ge R, Jiang S, Li G, Chen Y: microRNA-146b inhibits glioma cell migration and invasion by targeting MMPs. Brain Res. 2009, 1269: 158-165.

    Article  CAS  PubMed  Google Scholar 

  42. Ma L, Teruya-Feldstein J, Weinberg RA: Tumour invasion and metastasis initiated by microRNA-10b in breast cancer. Nature. 2007, 449 (7163): 682-688. 10.1038/nature06174.

    Article  CAS  PubMed  Google Scholar 

  43. Huang Q, Gumireddy K, Schrier M, Le Sage C, Nagel R, Nair S, Egan DA, Li A, Huang G, Klein-Szanto AJ: The microRNAs miR-373 and miR-520c promote tumour invasion and metastasis. Nat Cell Biol. 2008, 10 (2): 202-210. 10.1038/ncb1681.

    Article  CAS  PubMed  Google Scholar 

  44. Xia L, Zhang D, Du R, Pan Y, Zhao L, Sun S, Hong L, Liu J, Fan D: miR‒15b and miR‒16 modulate multidrug resistance by targeting BCL2 in human gastric cancer cells. Int J Cancer. 2008, 123 (2): 372-379. 10.1002/ijc.23501.

    Article  CAS  PubMed  Google Scholar 

  45. Zhu W, Shan X, Wang T, Shu Y, Liu P: miR‒181b modulates multidrug resistance by targeting BCL2 in human cancer cell lines. Int J Cancer. 2010, 127 (11): 2520-2529. 10.1002/ijc.25260.

    Article  CAS  PubMed  Google Scholar 

  46. Narvaiza I, Aparicio O, Vera M, Razquin N, Bortolanza S, Prieto J, Fortes P: Effect of adenovirus-mediated RNA interference on endogenous microRNAs in a mouse model of multidrug resistance protein 2 gene silencing. J Virol. 2006, 80 (24): 12236-12247. 10.1128/JVI.01205-06.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  47. Wyllie A, Carder P, Clarke A, Cripps K, Gledhill S, Greaves M, Griffiths S, Harrison D, Hooper M, Morris R: Apoptosis in carcinogenesis: the role of p53. Cold Spring Harbor symposia on quantitative biology: 1994. 1994, Cold Spring Harbor Laboratory Press, 403-409.

    Google Scholar 

  48. Wyllie A: Apoptosis and carcinogenesis. Eur J Cell Biol. 1997, 73 (3): 189-

    CAS  PubMed  Google Scholar 

  49. Chen L, Tang Y, Wang J, Yan Z, Xu R: miR-421 induces cell proliferation and apoptosis resistance in human nasopharyngeal carcinoma via downregulation of FOXO4. Biochem Biophys Res Commun. 2013, 435 (4): 745-750. 10.1016/j.bbrc.2013.05.056.

    Article  CAS  PubMed  Google Scholar 

  50. Lin RJ, Lin YC, Yu AL: miR‒149* induces apoptosis by inhibiting Akt1 and E2F1 in human cancer cells. Mol Carcinog. 2010, 49 (8): 719-727.

    CAS  PubMed  Google Scholar 

  51. Welch C, Chen Y, Stallings R: MicroRNA-34a functions as a potential tumor suppressor by inducing apoptosis in neuroblastoma cells. Oncogene. 2007, 26 (34): 5017-5022. 10.1038/sj.onc.1210293.

    Article  CAS  PubMed  Google Scholar 

  52. Qian L, Van Laake LW, Huang Y, Liu S, Wendland MF, Srivastava D: miR-24 inhibits apoptosis and represses Bim in mouse cardiomyocytes. J Experimental Med. 2011, 208 (3): 549-560. 10.1084/jem.20101547.

    Article  CAS  Google Scholar 

  53. Li J-H, Xiao X, Zhang Y-N, Wang Y-M, Feng L-M, Wu Y-M, Zhang Y-X: MicroRNA miR-886-5p inhibits apoptosis by down-regulating Bax expression in human cervical carcinoma cells. Gynecol Oncol. 2011, 120 (1): 145-151. 10.1016/j.ygyno.2010.09.009.

    Article  CAS  PubMed  Google Scholar 

  54. Li J, Fu H, Xu C, Tie Y, Xing R, Zhu J, Qin Y, Sun Z, Zheng X: miR-183 inhibits TGF-β1-induced apoptosis by downregulation of PDCD4 expression in human hepatocellular carcinoma cells. BMC Cancer. 2010, 10 (1): 354-10.1186/1471-2407-10-354.

    Article  PubMed  PubMed Central  Google Scholar 

  55. Levy D, Kessler D, Pine R, Reich N, Darnell J: Interferon-induced nuclear factors that bind a shared promoter element correlate with positive and negative transcriptional control. Genes Dev. 1988, 2 (4): 383-393. 10.1101/gad.2.4.383.

    Article  CAS  PubMed  Google Scholar 

  56. Karupiah G, Xie Q-w, Buller R, Nathan C, Duarte C, Macmicking JD: Inhibition of viral replication by interferon-gamma-induced nitric oxide synthase. Science. 1993, 261 (5127): 1445-1448. 10.1126/science.7690156.

    Article  CAS  PubMed  Google Scholar 

  57. Lee SB, Esteban M: The interferon-induced double-stranded RNA-activated protein kinase induces apoptosis. Virology. 1994, 199 (2): 491-496. 10.1006/viro.1994.1151.

    Article  CAS  PubMed  Google Scholar 

  58. Terenzi F, Hui DJ, Merrick WC, Sen GC: Distinct induction patterns and functions of two closely related interferon-inducible human genes, ISG54 and ISG56. J Biol Chem. 2006, 281 (45): 34064-34071. 10.1074/jbc.M605771200.

    Article  CAS  PubMed  Google Scholar 

  59. Terenzi F, White C, Pal S, Williams BR, Sen GC: Tissue-specific and inducer-specific differential induction of ISG56 and ISG54 in mice. J Virol. 2007, 81 (16): 8656-8665. 10.1128/JVI.00322-07.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  60. Yang Z, Liang H, Zhou Q, Li Y, Chen H, Ye W, Chen D, Fleming J, Shu H, Liu Y: Crystal structure of ISG54 reveals a novel RNA binding structure and potential functional mechanisms. Cell Res. 2012, 22 (9): 1328-1338. 10.1038/cr.2012.111.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  61. Stawowczyk M, Van Scoy S, Kumar KP, Reich NC: The interferon stimulated gene 54 promotes apoptosis. J Biol Chem. 2011, 286 (9): 7257-7266. 10.1074/jbc.M110.207068.

    Article  CAS  PubMed  Google Scholar 

  62. Lindsten T, Ross AJ, King A, Zong W-X, Rathmell JC, Shiels HA, Ulrich E, Waymire KG, Mahar P, Frauwirth K: The combined functions of proapoptotic Bcl-2 family members bak and bax are essential for normal development of multiple tissues. Mol Cell. 2000, 6 (6): 1389-1399. 10.1016/S1097-2765(00)00136-2.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

Pre-publication history

Download references

Acknowledgements

Supported by National Natural Science Foundation of China, No. 81301763, Henan Provincial Key Scientific and Technological Projects (No. 142102310473).

Disclosures

All authors have nothing to disclose.

Author information

Author notes

    Authors and Affiliations

    1. Oncology Department of the First Affiliated Hospital of Henan, University of Science and Technology, No. 24 Jinghua Road, Luoyang, Henan, China

      Xiaoshan Feng, Ying Wang, Zhikun Ma, Ruina Yang, Shuo Liang, Mengxi Zhang, Shiyuan Song, Shuoguo Li, Gang Liu & Shegan Gao

    2. State Key Laboratory of Cancer Biology and Xijing Hospital of Digestive Diseases, Fourth Military Medical University, Xi’an, Shaanxi, China

      Daiming Fan

    Authors
    1. Xiaoshan Feng
      View author publications

      You can also search for this author in PubMed Google Scholar

    2. Ying Wang
      View author publications

      You can also search for this author in PubMed Google Scholar

    3. Zhikun Ma
      View author publications

      You can also search for this author in PubMed Google Scholar

    4. Ruina Yang
      View author publications

      You can also search for this author in PubMed Google Scholar

    5. Shuo Liang
      View author publications

      You can also search for this author in PubMed Google Scholar

    6. Mengxi Zhang
      View author publications

      You can also search for this author in PubMed Google Scholar

    7. Shiyuan Song
      View author publications

      You can also search for this author in PubMed Google Scholar

    8. Shuoguo Li
      View author publications

      You can also search for this author in PubMed Google Scholar

    9. Gang Liu
      View author publications

      You can also search for this author in PubMed Google Scholar

    10. Daiming Fan
      View author publications

      You can also search for this author in PubMed Google Scholar

    11. Shegan Gao
      View author publications

      You can also search for this author in PubMed Google Scholar

    Corresponding authors

    Correspondence to Gang Liu, Daiming Fan or Shegan Gao.

    Additional information

    Competing interests

    We have not received reimbursements, fees, funding, or salary from an organization that may in any way gain or lose financially from the publication of this manuscript in the past five years, now and in the future. We do not hold any stocks or shares in an organization that may in any way gain or lose financially from the publication of this manuscript. We do not hold and are not currently applying for any patents relating to the content of the manuscript. All authors have nothing to disclose.

    Authors’ contribution

    XS F and YW performed data analyses and wrote the manuscript. ZK M performed the qRT-PCR examination. RN Y, MX Z and S L performed cell culture and cell transfection. G L, DM F and SG G initiated the project, designed the experiments and interpreted the data. SG G acted as a guarantor for the data in the manuscript. All authors read and approved the final manuscript.

    Xiaoshan Feng, Ying Wang, Zhikun Ma contributed equally to this work.

    Electronic supplementary material

    Additional file 1: Table S1: Antibodies used in western blotting assay (DOCX 15 KB)

    12885_2013_4823_MOESM2_ESM.tiff

    Additional file 2: Figure S1: miR-645 expression of SGC7901 and BGC-823 was significantly up-regulated compared with immortalized GC cell line, GES-1. miR-645 expression level in SGC7901 and BGC-823 were 6.9 and 4.4 - fold higher than in GES-1 (One-way ANOVA analysis, F = 129.393, ***P < 0.001). (TIFF 641 KB)

    12885_2013_4823_MOESM3_ESM.tiff

    Additional file 3: Figure S2: Wild-type and mutant IFIT2-3′UTR containing the putative binding site of miR-645 were cloned into psiCHECK-2 vector. A. IFIT2-3′UTR was amplified from genomic DNA of SGC7901. B. Lane 1 & 3: Recombinant plasmids of IFIT2-1, IFIT2-2 respectively; lane 2 & 4: Results of enzyme digestion of recombinant plasmids of IFIT2-1and IFIT2-2 respectively. Results showed that IFIT2-1/2 have been successfully inserted into the vectors (M1: DL2000 DNA Marker; M2: DL1 kb DNA Marker; ZTBT2-1/2 bands: 1902 bp; Vectors bands: 6.1 Kb). C. M1: 1 kb DNA Ladder Marker. Lane 1: amplification of mutIFIT2 PCR1. One band of mutIFIT2 (8.1 Kb) demonstrated the successful PCR of mutant amplification. D. Sequencing data of WT-IFIT2 and MT –IFIT2. (TIFF 3 MB)

    Authors’ original submitted files for images

    Rights and permissions

    Open Access This article is published under license to BioMed Central Ltd. This is an Open Access article is distributed under the terms of the Creative Commons Attribution License ( https://creativecommons.org/licenses/by/2.0 ), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver ( https://creativecommons.org/publicdomain/zero/1.0/ ) applies to the data made available in this article, unless otherwise stated.

    Reprints and permissions

    About this article

    Check for updates. Verify currency and authenticity via CrossMark

    Cite this article

    Feng, X., Wang, Y., Ma, Z. et al. MicroRNA-645, up-regulated in human adencarcinoma of gastric esophageal junction, inhibits apoptosis by targeting tumor suppressor IFIT2. BMC Cancer 14, 633 (2014). https://doi.org/10.1186/1471-2407-14-633

    Download citation

    • Received:

    • Accepted:

    • Published:

    • DOI: https://doi.org/10.1186/1471-2407-14-633

    Keywords

    BMC Cancer

    ISSN: 1471-2407

    Contact us