Patients and samples

Between January 2005 and August 2012, 70 patients with hepatocellular carcinoma (HCC) were included in this study in the Department of Hepatobiliary Surgery of Drum Tower Hospital. None of the patients had undergone any preoperative therapies. Three different types of tissues from each HCC patient were assembled immediately after surgical resection: tumor-free tissue >5 cm far from the tumor edge (TF), adjacent nonmalignant tissue within 2 cm (AT), and tissue from the tumor (TT). Areas of tissue necrosis and hemorrhage were excluded. Normal liver tissues from 10 liver transplant donors served as healthy control (HC) while 10 patients with liver cirrhosis as cirrhosis control (CC).

All of the tissue samples were snap frozen immediately after resection and kept in liquid nitrogen until they were used for experiments. A senior pathologist did histopathologic examination of all specimens with experience in HCC pathology (Dr. WU Hongyan), who was unaware of the preoperative clinical data and immunostaining results. Tumor differentiation was assessed according to Edmonson and Steiner grading system. Serial sections of the tumors and surrounding liver were examined to identify any tumor encapsulation, microscopic venous invasion, and microsatellite lesions. The degree of HCC invasiveness was verified according to the invasiveness scoring system for HCC. Tumor stage was defined according to tumor-node-metastasis (TNM) classification of the American Joint Committee on International Union against Cancer.

Preoperative clinical and laboratory, and pathological data were prospectively assembled for each patient in our HCC database. All patients were followed and monitored regularly for tumor recurrence by alpha-fetoprotein level (monthly) and chest X-ray, together with B ultrasonic or computed tomography scan (every 3 months). A diagnosis of recurrence was based on typical imaging appearance in computed tomography scan and an elevated alpha-fetoprotein level. All of the patients were followed until death or until the study closing date of January 1st, 2013.

This study was approved by the Scientific Research Ethics Committee of the affilisted Drum Tower Hospital, Medical School of Nanjing University, and an informed consent was obtained from all participants.

Immunohistochemistry

Formalin-fixed and paraffin-embedded HCC sections with a thickness of 4 μm were dewaxed in xylene and graded alcohols, hydrated and washed in phosphate buffered saline (PBS). After pretreatment in a microwave oven, endogenous peroxidase was inhibited by 3% hydrogen peroxide in methanol for 20 min, followed by avidin-biotin blocking using a biotin-blocking kit (DAKO, Germany). Slides were then immunoassayed with the antibodies to human GGPPS1 (1:200; Proteintech), CD34 (1:300; Santa Cruz Biotechnology), VEGF₁₆₅ (1:100, Santa Cruz), p53, PCNA, EGFR, or COX-2 (1:200; DAKO). A subsequent reaction was performed with biotin-free HRP enzyme-labeled polymer from an En Vision plus detection system (DAKO, CA). Positive reactions were visualized with diaminobenzidine (DAB) solution followed by counterstaining with hematoxylin. Negative controls were performed using non-immune goat serum instead of the primary antibodies.

Semi-quantitative IHC detection was used to determine the GGPPS1, PCNA, EGFR, or COX-2 protein levels. A brown particle in nuclei was considered as positive labeling. Immunostain was scored using a 4-point scale (0–4) system according to the intensity of staining and the percentage of positive cells. IHC evaluation was performed according to the method described before [21]. For each case, 1000 cells were randomly selected and scored. HCC sections were observed under light microscopy and the staining intensity scores were independently assessed by 2 pathologists (Dr. CHEN Jun and WU Hongyan).

Real-time PCR

Acid guanidine thiocyanatephenol-chloroform extraction was used to isolate total RNA from liver tissues [22]. With random hexamer primers, the maximum allowed volumes of RNA samples were transcribed with ExScript RT reagent kit (TaKaRa) according to the manufacturer’s protocol. RNA samples without reverse transcription were used as negative controls.

PCR Primers and probes for human GGPPS1 and 18S genes were designed with Primer Express 2.0 software (Applied Biosystems) and synthesized by Genecore. The basic information on primers, including gene name, forward primer, reverse primer are the following: GGPPS1, CCAGGTAAACAAGTGAGAACCAA, CGTCGGAGTTTTGAGTTGTCT, and 18S, GTCTGTGATGCCCTTAGATG, AGCTTATGACCCGCACTTAC. For the amplification of GGPPS1 and 18S genes, real-time PCR was done in triplicate for each sample in a 20 μl reaction mixture, which consisted of template DNA (2 μl), primers (900 nmol/L), probe (250 nmol/L), Mg²⁺ (5 mmol/L) and Ex Taq HS (0.1 units/AL; ExScript Real-time PCR Kit, TaKaRa). PCR was done in a Stratagene Mx3005P instrument using the following thermal cycles: one cycle of 1 min at 95°C, 40 cycles of 15 s at 95°C, 15 s at 58°C and 30s at 72°C. Amplification efficiency of each individual sample was calculated by version 7.0 of LinRegPCR program (a gift from C.R.Ramakers, 3 Academic Medical Centre, University of Amsterdam, Amsterdam, the Netherlands). According to the method tested by Pfaffl, the relative expression ratio of a targeted gene was calculated based on efficiency and the Ct compared with a reference gene (18S).

Western blots

Tissue lysates were boiled with 6 × sodium dodecyl sulfate (SDS) loading buffer and then fractionated by SDS-PAGE. The proteins were transferred to PVDF membrane and incubated with 5% of non-fat milk. The membranes were then incubated overnight at 4°C with primary antibody against human GGPPS1 (Proteintech, at a 1:200 dilution) or beta-actin (Boster, at a 1:1000 dilution). After being washed with PBST for 30 min, the membrane was probed with HRP-conjugated secondary antibody (Boster, at a 1:10000 dilution) for 1 h at room temperature. ECL detection reagent was used to demonstrate the results.

Statistical analysis

Data were expressed as mean ± SD with the range given in parentheses, or categorized. Statistical comparisons were done using the Mann–Whitney U test, t test, ANOVA, or linear regression when data were normally distributed. Wilcoxon matched paired test was used to determine the significance of GGPPS1 expression among different kinds of liver tissues. χ2 test was performed to analyze the correlation between GGPPS1 expression and clinic pathological parameters. All statistical procedures were done using SAS (version 9.0; SAS, Inc.). Values of p < 0.05 were considered statistically significant.

Characteristics of patients with HCC

In 70 patients (62 males and 8 females; median age, 54.09 years) who underwent curative resection (60 cases for regular hepatectomy and 10 for orthotopic liver transplantation), the average tumor size was 7.59 × 5.88 cm. Liver cirrhosis was detected in 42 patients, 9 patients had chronic hepatitis, and the remaining 19 patients without hepatitis or cirrhosis.

The etiologies of underlying liver diseases were hepatitis B in 42 patients, hepatitis C in 6 patients, and mixed viral infection in 3 patients. According to International Union Against Cancer recommendation, 15 patients were classified as stage I, 19 patients as stage II, 24 patients as stage III, and 12 patient as stage IV. Sixty-one patients were in child’s class A, 6 in class B and 3 in class C. The basic information of all the patients was attached in Additional file 1.

Higher expression of GGPPS1 in tumor tissue comparing to adjacent nonmalignant tissues

To investigate the expression of GGPPS1 in HCC patients, Q-PCR was used to analyze the expression of GGPPS1 mRNA in 34 paired TT, AT and TF liver tissues. The results demonstrated that GGPPS1 mRNA was upregulated in 85.29% TT compared with TF and AT, and the mean relative level of GGPPS1 mRNA in TT and AT comparing to TF was 5.69 and 1.28 (Figure 1A). Consistently, western blots showed that protein level of GGPPS1 in TT was noticeably higher than that in TF and AT in 11 of the 15 patients (Figure 1B). However, there was no difference of GGPPS1 in mRNA and protein level between AT and TF (Figure 1C). To further confirm the results, immunohistochemistry was performed to assess the expression of GGPPS1. GGPPS1 was positively stained in 67.14% of TT, which was higher than that in AT (30%), TF (24.29%), CC (30%), and HC (zero) (Figure 1D, p < 0.001).

GGPPS1 mainly distributes in the cytoplasm of liver tumor cells

Our previous investigations reported that GGPPS1 was also found in airway epithelium, alveolar epithelial cells, and invasive inflammatory cells in cigarette smoke-related lungs [16]. The distribution and expression of GGPPS1 in paired TT, AT and TF (n = 70), cirrhotic liver as cirrhosis control (CC, n = 10), and normal liver as healthy control (HC, n = 10), was evaluated with immunohistochemistry. The positive staining of GGPPS1 mainly existed in cytoplasm of tumor cells (Figure 2A and B). Of note, GGPPS1 signals were less in the hepatocytes in AT and TF (Figure 2C and D, E and F). In cirrhotic liver or normal, GGPPS1 was negative or weakly positive (Figure 2G and H, I and J). Therefore, GGPPS1 mainly distributes in the cytoplasm of liver tumor cells.

Expression of GGPPS1 in TT is associated with cirrhosis and GGPPS1 in AT

Expression of GGPPS1 is associated with biological character of HCC