Skip to main content

Table 1 Primer sequences

From: NOTCH1 mutations influence survival in chronic lymphocytic leukemia patients

Gene-exon-segment Application Forward primer Reverse primer Product size/bp TA/°C
Notch1- 26-a PCR/SSCA AGCCCCCTGTACGACCAGTA CTTGCGCAGCTCCTCCTC 283 63.5
Notch1- 26-b PCR/SSCA ACACGGCCAGCAGATGAT GAGAGTTGCGGGGATTGAC 231 57.1
Notch1- 27 PCR/SSCA GTGGCGTCATGGGCCTCA TAGCAACTGGCACAAACAGC 342 63.2
Notch1- 34a PCR/SSCA AACCACCTGCCTGGGATG CGCATTGACCATTCAAACTG 232 57.1
Notch1- 34b PCR/SSCA GGGCCCTGAATTTCACTGT AGGCCCTGGTAGCTCATCAT 229 60
Notch1- 34c PCR/SSCA GCTGCACAGTAGCCTTGCT CTGAGCTCACGCCAAGGT 224 58
Notch1- 34d PCR/SSCA ACATCCAGCAGCAGCAAAG GTGGGACCAGCGAGGATG 222 58
Notch1- 34e PCR/SSCA CACTATTCTGCCCCAGGAGA CAGTCGGAGACGTTGGAATG 234 58
Notch1- 34f PCR/SSCA ACAGCTACTCCTCGCCTGTG AAGGCTTGGGAAAGGAAGC 248 58
Notch1-6 PCR/SSCA GCAGCTGCCCGGGGCCGACA TCAGGCCTGGCCCATGTGA 330 62
Notch1-7 PCR/SSCA ATGCCTGGCCAGGGGCCGT TCGACTTCTCATCGGTTCT 273 58
Notch1-8 PCR/SSCA CCGATGGGGGTGGTGTGCAGT TGCCCAGCCTCGACTCGGTT 331 63
Notch1-11 PCR/SSCA AGTCCTAAGTCTTCCTGTGCC AGGCCCGCCCTGCCCACT 325 65
Notch1-12 PCR/SSCA AGGACTGACCGACACGTG TCTGAGCACAGTGCAGTCA 183 53
Notch1-13 PCR/SSCA TGGGCGCTGGGCCTCGGA ACTGATGTGTCCCCATGA 268 54
Gene-exon-segment Application Forward primer Reverse primer Product size/bp T A /°C
Notch2- 26-1 PCR/SSCA TTCTCTGCTTCCCCTTACCT TTAATGCGCAGGTTGGTGT 250 54.1
Notch2- 26-2 PCR/SSCA TGGTATTGATGCCACCTGAA GCCTTGAAGTTCAGAAACCAA 240 54.1
Notch2- 27 PCR/SSCA TACCCCCATCTCTCCTCCTC AATTGTTCCCCCAATTGACA 250 55.2
Notch2- 34-1 PCR/SSCA TCCCCTGTTGATTCCCTAGA CACAATGTGGTGGTGGGATA 249 55.2
Notch2- 34-2 PCR/SSCA GCACTGTGCTTCCCTCAGT CTGCCTTTAGGGATGAGCTG 298 55.2
Notch2- 34-3 PCR/SSCA ACCCATCCTGGCATAGCTC TAGGCTGGGAGAATGGTCTG 287 55.2
Notch2- 34-4 PCR/SSCA TTTGCCCAGTGTGGCTTT GGTGATGAACTTGACCACTG 249 57.1
Notch2- 34-5 PCR/SSCA ACACCCAGTCACAGTGGTCA TGTCTCTACACTGGAGGTGGAC 242 61.6