Skip to main content

Advertisement

Table 2 Nomenclatures of primer sets and sequences of RT-PCR primers.

From: Modulation of mdm2 pre-mRNA splicing by 9-aminoacridine-PNA (peptide nucleic acid) conjugates targeting intron-exon junctions

Primer set(a), Primer name sequence (5'→3') Product size (bp) Remarks
A Exo2S CGATTGGAGGGTAGACCTGT 161 intron2 5'-splice site
  Int2AS CACGATGAAAACTGGAAATCA   
B Int2Sa TGCTTGTAGCTTTAGTTTTA 90 intron2
  Int2AS CACGATGAAAACTGGAAATCA   
C Int2Sb GATTTCCAGTTTTCATCGTGT 120 intron2 3'-splice site
  Exo3AS GGTCTCTTGTTCCGAAGCTG   
D Exo3S CAGCTTCGGAACAAGAGACC 169 intron3 5'-splice site
  Int3AS GCAGTTACGCCAGAGGTAGC   
E Int3S TCTTTGCTCTTTTGGATTGGA 251 intron3 3'-splice site
  Exo4AS TTTTTGTGCACCAACAGACTTT   
F Exo4S AAGCCATTGCTTTTGAAGTTATT 151 intron4 5'-splice site
  Int4AS GCCAATTTCTCCACATGGTC   
G Int4S TGGTTCCTGGTTGTTTACCC 215 intron5 3'-splice site
  Exo5AS CACGCCAAACAAATCTCCTA   
H ActF1 CCCTGGAGAAGAGCTACGAG 223 β-actin (771-993)
  ActR1 ATGCCAGGGTACATGGTGGT   
I ActF2 CTTCCTGGGCATGGAGTC 166 β-actin (862-1027)
  ActR2 CAGGGCAGTGATCTCCTTCT   
  1. (a)A-H indicates the target sequences for RT-PCR within the mdm2 pre-mRNA. For primer set H and I, location of the amplification products within the β-actin (Accsession#, BC001301) are indicated.