Skip to main content

Table 1 Primer sequence and synthesis condition

From: NudCD1 as a prognostic marker in colorectal cancer and its role in the upregulation of cellular spindle assembly checkpoint genes and LIS1 pathways

GENE Primer Length (bp) Tm (degrees centrigade)
GAPDH ACAACTTTGGTATCGTGGAAGG 101 60.7
GCCATCACGCCACAGTTTC 60.54
BUB1 GGAGAAGGAGCCTTTGCCCAG 117 60.14
GTAGAATTCCCAGGGGTTGGCAG 60.62
BUBR1 CTTCTCCCTACCAGGTAGACCTG 173 60.77
GGCATTCAGAATCCGCACAAAG 60.75
MAD1 GAGTCTGCCATCGTCCAAGGAG 157 60.03
CGTGGTGATGTCGATCTGGTAGC 60.04
CDC20 CTCAGGCCATGGCTTTGCACAG 158 60.99
TCAGGGTCTCATCTGCTGCTGC 61.65
TTK GGGACCCAAAACAGAGGATATCC 134 60.8
ACCAACAAGTTGGCCCAGAAC 60.82
LIS1 TCTTGCTGTCTGGATCCAGAGAC 156 60.8
GGGTCTTGTCATCAGCACAACTC 60.82
DYNC1H1 TGGAAGTCAACGTCACCACCTC 128 60.8
GGTTGAGATGGCATTGGACAGTG 60.82
DYNLL1 CTCAGGCGCTGGAGAAATACAAC 95 60.8
GATGCAATGCCAGGTGGGATTG 60.82