Skip to main content

Table 2 Primers used to amplify the V4-V6 regions encoding for the 16 S rRNA for sequencing library preparations

From: Microbiome composition indicate dysbiosis and lower richness in tumor breast tissues compared to healthy adjacent paired tissue, within the same women

ID of the 16 S primer

Sequence

Forward 16 S V4-V6

TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCAGCAGCCGCGGTAATAC

Reverse 16 S V4-V6

GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTGACGACAGCCATGC

  1. Illumina 16 S PCR primers with overhang adapters and sequences complementary to V4-V6 regions (in bold)
Back to article page

BMC Cancer

ISSN: 1471-2407

Contact us