Skip to main content

Table 2 Primers for quantitative PCR of the Dnmt3a promoter region

From: Dnmt3a is downregulated by Stat5a and mediates G0/G1 arrest by suppressing the miR-17-5p/Cdkn1a axis in Jak2V617F cells

Number Primer Sequences (5′-3′)
1 Dnmt3a-1F GGAATGAGGTGGAGTCCTGA
Dnmt3a-1R CATGGCCATAGGACAGAGGT
2 Dnmt3a-2F ACCTCTGTCCTATGGCCATG
Dnmt3a-2R CCCCAGTCCCTGACAGTG
3 Dnmt3a-3F CACTGTCAGGGACTGGGG
Dnmt3a-3R GTGGGTCACGACCTCTTTGA
4 Dnmt3a-4F TCAAAGAGGTCGTGACCCAC
Dnmt3a-4R GGGCACTTTCTCCCTGAAGT
5 Dnmt3a-5F ACTTCAGGGAGAAAGTGCCC
Dnmt3a-5R TGTCAGGGGACTGAGCTCTT
6 Dnmt3a-6F AAGAGCTCAGTCCCCTGACA
Dnmt3a-6R CACTGTTAGAGCAATCGGATGA
7 Dnmt3a-7F TAGCCCTGGCTGTATTGGA
Dnmt3a-7R GCCTGAATTTGATTCCCAGA
8 Dnmt3a-8F TTTTGTGCCTGGTCTCCTTC
Dnmt3a-8R AGCTTGATGGCAGAGTGCTT