Skip to main content

Table 2 Primers designed for qRT-PCR validation of mRNA

From: TBX5-AS1, an enhancer RNA, is a potential novel prognostic biomarker for lung adenocarcinoma

Name Bidirectional primer sequence Tm (°C) Product length (bp)
β-actin(H) F:5′ GTGGCCGAGGACTTTGATTG3’ 60 73
R:5′ CCTGTAACAACGCATCTCATATT3’
TBX5 F:5′ GGTCTCTTTTGGTGGTCCTTTT 3’ 60 195
R:5′ TCAGGCTCCAGAGGCGTGT 3’