Skip to main content

Table 2 Primers used for detection of HPV targeting L1 region

From: Mutational profiles of marker genes of cervical carcinoma in Bangladeshi patients

Primers Primer Sequence Amplicon size
(bp)
Annealing temperature
(°C)
References
MY11 (forward) GCMCAGGGWCATAAYAATGGG 450 55 Sin Hang Lee, 2012 [17]
MY09 (reverse) CGTCCMARRGGAWACTGATC
GP5 (forward) TTTGTTACTGTGGTAGATAC 150 49.2 de Roda Husman et al., 1995 [18]
GP6 (reverse) GAAAAATAAACTGTAAATCA
HPV-16 specific forward (inner) TACCTACGACATGGGGAGGA 194 55 Ge et al., 2012 [19]
HPV-16 specific reverse (inner) GCAATTGCCTGGGATGTTAC
HPV-18 specific forward (inner) TGGTGTTTGCTGGCATAATC 339 55 Ge et al., 2012 [19]
HPV-18 specific reverse (inner) GCAGCATCCTTTTGACAGGT
  1. Key to degenerate nucleotides: M = (A + C), R = (A + G), W = (A + T), Y = (C + T)