Skip to main content

Table 1 The sequence information of primers used in this study

From: LncRNA MT1JP plays a protective role in intrahepatic cholangiocarcinoma by regulating miR-18a-5p/FBP1 axis

Name Sequence (5′-3′)
MT1JP Forward GAAATGGACCCCAACTACTC
MT1JP Reverse GTTCCCACATCAGGCACAGC
β-actin Forward CACTGTGCCCATCTACGAGG
β-actin Reverse TAATGTCACGCACGATTTCC
hsa-miR-18a-5p RT GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACCTATCT
5S RT GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACAAAGCCTAC
hsa-miR-18a-5p Forward TAAGGTGCATCTAGTGCAGATAG
hsa-miR-18a-5p Reverse GCAGGGTCCGAGGTATTC
5S Forward GATCTCGGAAGCTAAGCAGG
5S Reverse TGGTGCAGGGTCCGAGGTAT