Skip to main content

Table 1 Primer sequences for RT-qPCR

From: MicroRNA-545 suppresses progression of ovarian cancer through mediating PLK1 expression by a direct binding and an indirect regulation involving KDM4B-mediated demethylation

Gene Primer sequence (5′-3′)
miR-545 F: CGACAAGGGTCAGCAAACATT
R: GCAGGGTCCGAGGTATTC
Bax F: TCAGGATGCGTCCACCAAGAAG
R: TGTGTCCACGGCGGCAATCATC
Bcl-2 F: ATCGCCCTGTGGAGAACTACTGAGT
R: GCCAGGAGAAATCAAACAGAGGC
KDM4B F: GCCGAGAGGAAGTTCAACGCAG
R: TGCCTCCTTCTCAGAGTGTGTAGG
PLK1 F: GCACAGTGTCAATGCCTCCAAG
R: GCCGTACTTGTCCGAATAGTCC
U6 F: CTCGCTTCGGCAGCACA
R: AACGCTTCACGCATTTGC
GAPDH F: GTCTCCTCTGACTTCAACAGCG
R: ACCACCCTGTTGCTGTAGCCAA
  1. Note: RT-qPCR reverse transcription quantitative polymerase chain reaction, Bcl-2 B-cell lymphoma-2, Bax Bcl-2-associated X, KDM4B Lysine (K)-specific demethylase 4B, PLK1 Polo-like kinase 1, GAPDH glyceraldehyde-3-phosphate dehydrogenase, F forward, R reverse