Skip to main content

Table 1 Oligonucleotides used in this study

From: Serum miRNAs, a potential prognosis marker of loco-regionally advanced nasopharyngeal carcinoma patients treated with CCRT

Primer set nameReverse transcripatase reation primerReal-time quantitative PCR primerTm (°C)Length (bp)
U65’CGCTTCACGAATTTGCGTGTCAT3’Forward:5’GCTTCGGCAGCACATATACTAAAAT3′
Reverse:5’CGCTTCACGAATTTGCGTGTCAT3’
6089
miR-165’GGCGTAGGCAGTGCAGGGTCCGAGGTCTGCCTACGCCCGCCAATA3’16-F:TCGGCTAGCAGCACGT; 16-R:TGATTGCAGGGTCCGAG6060
miR-29a5’GCGTGGTCGGTAACTCGGACCCTTCTACCGACCACGCTAACCGA 3’29a-F:GAACCCCTTAGCACCATCT; 29a/b-R:AGCGTAACTCGGACCCTT6066
miR-29b5’GCGTGGTCGGTAACTCGGACCCTTCTACCGACCACGCAACACTG3’29b-F:GAACCCCTTAGCACCATTT; 29a/b-R:AGCGTAACTCGGACCCTT6066
miR-26b5’GCCGTGACCGTCAGTGGAGGCAAGCCAGACGGTCACGGCACCTAT 3’26b-F:ACGACGGTTTCAAGTAATTCA;
26b-R: TCTCGTCAGTGGAGGCAA
6065
miR-125b5’GCCGTACCGTCAGTGGAGGCAAGCCAGACGGTACGGCTCACAAGT 3’125b-F:CTGGACTCCCTGAGACCCT; 125b-R:ATCCGTCAGTGGAGGCA6066
miR-1435’GGCGTCAGCCAGAGTGGAGGCAAGCCACTGGCTGACGCCGAGCTAC 3’143-F:GCCAGTCCTGAGATGAAGCAC; 143-R:TGAAGAGTGGAGGCAAGC6062