Skip to main content

Table 1 Primer sequences for six hub genes and GAPDH

From: Construction of a nine DNA repair-related gene prognostic classifier to predict prognosis in patients with endometrial carcinoma

Gene Primer Sequences
TP53-F CAGCACATGACGGAGGTTGT
TP53-R TCATCCAAATACTCCACACGC
RFC2 -F GTGAGCAGGCTAGAGGTCTTT
RFC2 -R TGAGTTCCAACATGGCATCTTTG
SEC61A1-F GGACCGCTATCACCCTCTTTA
SEC61A1-R TCCATCAATGTGCCTCTGTTAGA
TAF10-F GCCATATCTAACGGGGTTTACG
TAF10-R GCACGGTTCAGGTAGTAACCAG
UMPS-F TTGGTGACGGGTCTGTACGA
UMPS-R GAAGACGCGGTCGAGACAC
DDB2 -F ACCTCCGAGATTGTATTACGCC
DDB2-R TCACATCTTCTGCTAGGACCG
GAPDH-F ACCACAGTCCATGCCATCAC
GAPDH-R TCTAGACGGCAGGTCAGGTC
\