Skip to main content

Table 1 Primers used for qPCR

From: Tumor quiescence: elevating SOX2 in diverse tumor cell types downregulates a broad spectrum of the cell cycle machinery and inhibits tumor growth

Name Forward primer sequence 5′-3’ Reverse primer sequence 5′-3’
GAPDH ACAGCGACACCCACTCCTCC GAGGTCCACCACCCTGTTGC
OCT4 GACAACAATGAGAACCTTCAGGAGA CTGGCGCCGGTTACAGAACCA
NANOG ATCCAGCTTGTCCCCAAAG ATTTCATTCGCTGGTTCTGG