Skip to main content

Table 2 Sequence of siRNA/vector/inhibitor used in cell transfection

From: Roles of DANCR/microRNA-518a-3p/MDMA ceRNA network in the growth and malignant behaviors of colon cancer cells

Gene Sequence (5′-3′)
DANCR siRNA-1 AGCCAACTATCCCTTCAGT
DANCR siRNA-2 GAGCTAGAGCAGTGACAAT
MDM2 CCAGCTGGAGACAAGTCAGG
MiR-518a-3p inhibitor ACTAGTTAT AACCCTAGGAATTTAGACAAC
\