Skip to main content

Table 1 Primer sequences used for this study

From: RIPK1 polymorphisms alter the susceptibility to cervical Cancer among the Uyghur population in China

SNPFirst-PCRPSecond-PCRPUEP_DIRUEP_SEQ
rs6907943ACGTTGGATGACCAGGTGTTGGAGTTCAGCACGTTGGATGGGTGTTTGTTTGCAGCTCGTFtgtgTGCAGCTCGTTAGCAT
rs2077681ACGTTGGATGGTGAATTTAACTGCACTGGGACGTTGGATGAACCTCGAGGACATCATGCCRggggtACATCATGCCAAGTGGA
rs9503400ACGTTGGATGAGTAAGTGCTCAGTAAACGGACGTTGGATGTGCTCAAGGCTGTCTAGGTGRggagGGCTGTCTAGGTGTTCTTTG
rs17548629ACGTTGGATGTCAACAGTATCAGCCCTGAGACGTTGGATGTGGCATTCTGGTACCTTCACFccccTCACCCAGCCTGAGTG
  1. SNP Sing nucleotide polymorphism