Skip to main content

Table 1 Gene primers for real-time PCR

From: Screening differentially expressed genes of pancreatic cancer between Mongolian and Han people using bioinformatics technology

Gene SymbolGene IdPrimerBank IDAmplicon SizeForward PrimerReverse Primer
CPB1136054607079c1194CCAGCACGACCCAGATTGACAACCCGGCTATCAAACTGAGC
ITGA4367667191026c1139CACAACACGCTGTTCGGCTACGATCCTGCATCTGTAAATCGC
BIRC3330342307084c179AAGCTACCTCTCAGCCTACTTTCCACTGTTTTCTGTACCCGGA
PAK410,298126273532c1113GGACATCAAGAGCGACTCGATCGACCAGCGACTTCCTTCG
COL11A1130198985805c1128ACCCTCGCATTGACCTTCCTTTGTGCAAAATCCCGTTGTTT
GAPDH26,330126273608c1116TGTGGGCATCAATGGATTTGGACACCATGTATTCCGGGTCAAT
CPA11357221316610c182GCTGGTGTTGAGTGTCCTGTTGGCTACAGAGATTCGGAGCAC
CLPS389,383155029555c192GCGCTTCCGCAATATAAAAAGAACCGGAGTCCAAGTCCATGAG
PIK3CG529421237724c1150GGCGAAACGCCCATCAAAAAGACTCCCGTGCAGTCATCC
HLA-DPA13113335883184c1112ATGCGCCCTGAAGACAGAATGACACATGGTCCGCCTTGATG