Skip to main content

Table 1 Primers used for RT and qPCR

From: Long non-coding RNA PTTG3P functions as an oncogene by sponging miR-383 and up-regulating CCND1 and PARP2 in hepatocellular carcinoma

miR-383 RT primer5’GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACAGCCAC3’
miR-383Forward: 5’GGGAGATCAGAAGGTGATTGTGGCT3’
Reverse: 5’CAGTGCGTGTCGTGGAGT3’
U6 snRNAForward: 5’CTCGCTTCGGCAGCACA3’
Reverse: 5’AACGCTTCACGAATTTGCGT3’
GAPDHForward: 5’GGAGCGAGATCCCTCCAAAAT3’
Reverse: 5’GGCTGTTGTCATACTTCTCATGG3’
PTTG3PForward: 5’AAACGAAGAACCAGGCATCCTT3’
Reverse: 5’GGGAGCATCGAATGTTTTGCC3’
CCND1Forward: 5’GCTGCGAAGTGGAAACCATC3’
Reverse: 5’CCTCCTTCTGCACACATTTGAA3’
PARP2Forward: 5’GCCTTGCTGTTAAAGGGCAAA3’
Reverse: 5’TCCTTCACACTCCACATGAGCC3’