Skip to main content

Advertisement

Table 3 Primer sequences for quantitative reverse transcription polymerase chain reaction

From: Lnc-AL445665.1–4 may be involved in the development of multiple uterine leiomyoma through interacting with miR-146b-5p

Gene Forward primer Reverse primer
lnc-LHFPL3–5 5′ ACTTCTACTATTGATGCAGTCC 3’ 5′ AAGTTCAGAACTGACTGTCTAT 3’
lnc-GUCY1A3–1 5′ GCATCCAGACACTGCTTAATC 3’ 5′ GCAAGGAGGTGAAGGAATAG 3’
lnc-AL445665.1–4 5′ ATTCTGATTCCCTGTGTATCCA 3’ 5′ CTGTGACAGAAATAGGAATGCC 3’
lnc-RP4-725G10.1.1–8 5′ GCTCAGGACTTTCACTGATT 3’ 5′ GTTGTTTCAACTTCTTTCCCAC 3’
ACTB 5′ CCATCATGAAGTGTGACG 3’ 5′ GCCGATCCACACGGAGTA 3’
miR-146b-5p 5′ GCGCAGTGAGAACTGAATTCCA 3’ 5′ AGTGCGTGTCGTGGAGTCG3’
U6 5′ CGATACAGAGAAGATTAGCATGGC 3’ 5′ AACGCTTCACGAATTTGCGT 3’