Fig. 4

Diagrams of (a) the gene promoters of c-IAP1 and (b) XIAP and heat maps of the log₂ (fold change) mRNA levels of the GR and the IAP gene family. The gene promoters of a) c-IAP1, (b) XIAP and glucocorticoid receptor (N3RC1) response elements (GRE) are shown as white squares (GRE sequence: AGAACANNNTGTTCT). NF-κB response elements (ΚBRE sequence: AGTTGAGGGGACTTTCCCAGG) of the p65 subunit are shown as black squares. The diagrams were modified from those available in the eukaryotic promoter database [51, 52]. c Glucocorticoid receptor. d The eight members of the mammalian IAP family. The data were normalized to ethanol (ETOH)-treated cells. The data represent the fold increase over the control (ETOH ± standard deviation [SD]); n = three independent experiments