Skip to main content

Table 1 Primers used in Real-time PCR

From: miR-196a-5p promotes metastasis of colorectal cancer via targeting IκBα

Name Sequences
hsa-miR-196a-5p F: CCGACGTAGGTAGTTTCATGTT
R: GTGCAGGGTCCGAGGTATTC
RT:GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACCCCAAC
hsa-U6 F: CTCGCTTCGGCAGCACA
R: AACGCTTCACGAATTTGCGT
RT:GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACAAAATATGG
IκBα F: CATCCTGAAGGCTACCAACTAC
R: CATCAGCACCCAAGGACAC
β-actin F: CTTAGTTGCGTTACACCCTTTCTTG
R: CTGTCACCTTCACCGTTCCAGTTT
  1. F Forward, R Reserve