Skip to main content

Table 1 List of primers

From: ADSCs and adipocytes are the main producers in the autotaxin–lysophosphatidic acid axis of breast cancer and healthy mammary tissue in vitro

  Forward Primer (5′- > 3′) Reverse Primer (5′- > 3′)
Human HPRT AGTTCTGTGGCCATCTGCTT GGCTTTGTATTTTGCTTTTCCAGT
Human ATX CCTGCAGTGCTTTATCGGA TCAGATGGTCAGGAACGCTG
Human LPAR1 CTCGGCATAGTTCTGGACCC TTCTCATAGGCCAGCACGTC
Human LPAR2 TACCGAGAGACCACGCTCAG GCCTAAACCATCCAGGAGCA
Human LPAR3 CCGCATACAAGTGGGTCCAT GGGGTCCAGCATACCACAAA
Human LPAR4 AAAGATCATGTACCCAATCACCTT CTTAAACAGGGACTCCATTCTGAT
Human LPAR5 CGCCATCTTCCAGATGAAC TAGCGGTCCACGTTGATG
Human LPAR6 GGTAAGCGTTAACAGCTCCCACT TTTGAGGACGCAGATGAAAATGT
\