Skip to main content

Advertisement

Table 1 Primers information

From: The role of matrix metalloproteinase-9 as a prognostic biomarker in papillary thyroid cancer

Ref. Genes Primers 5′-3’ Tm PCR product size (bp)
NM_004994.2 MMP-9 Forward CTTTGAGTCCGGTGGACGAT 59 101
Reverse TCGCCAGTACTTCCCATCCT 60
NM_001101.3 β-actin Forward GATCAAGATCATTGCTCCTCCT 57 108
Reverse TACTCCTGCTTGCTGATCCA 58