Skip to main content

Table 2 Primers for PCR and pyrosequencing

From: Decreased methylation in the SNAI2 and ADAM23 genes associated with de-differentiation and haematogenous dissemination in breast cancers

Gene Orienta-tion Sequence (5′-3′) of PCR primer PCR product (bp) Sequence (5′-3′) of pyrosequencing primer Numb. of CpGs
ADAM23 a Forward
Reverse
[Biotin]GCGTCGTTTTAGTATTTTTAGGTT
TCCCCAACCACTACTCCCT
89 ACTACTCCCTCCCCC 8
uPA Forward
Reverse
TAGGTGTATGGGAGGAAGTA
[Biotin]CTCCCTCCCCTATCTTACA
165 GTTTTTTTTAAATTTTTGTGAG 7
CXCL12 b Forward
Reverse
TAGTGGGGTTTTGTTATAGGGATA
[Biotin]ACCTTTAACCTTCTCAAACTC
121 GGGTTTTGTTATAGGGATAAT 7
TWIST1 Forward
Reverse
GAAGGGGAGGGAAGGGG
[Biotin]TAACAATTCCTCCTCCCA
97 GGGAGGGAAGGGGGAG 3
SNAI1 Forward
Reverse
GTATTTGTTAGGGGAGTGGT
[Biotin]ACCACCCCCCTTTATCAC
72 GTTAGGGGAGTGGTTT 6
SNAI2 Forward
Reverse
[Biotin]GTTGGTTTGGTGTGGTGTAG
CCCTACCCCCCTAACTTCCAAATATAAT
100 CCTAACTTCCAAATATAATACAAC 5
  1. a,bSet of PCR primers and pyrosequencing primers were previously published by Zmetakova and colleagues [54]