Skip to main content

Advertisement

Table 1 Primers used for RT_PCR of human GABA receptor subunits and GADs

From: GABAB receptor regulates proliferation in the high-grade chondrosarcoma cell line OUMS-27 via apoptotic pathways

Target (accession no.)   Primer sequence (5,_3’) Position Length (bp)
GABAAα1 (NM_000806) F GGAATTGT C CAGT CAAGTACAGG 1150–1172 532
R TTGTTTCGGGCTTGACCTC 1663–1681
GABAAα2 (NM_000807> F GCTTATGCAGTGGCTGTTGC 1411–1430 257
R GGACTGAC C C CTAATACAGGTTC 1645–1667
GABAAα3 (NM_000808) F C CAC CT AT C C CAT CAAC CTG 1442-1461 261
R TGCCCTTGATAGCTGACTCC 1683–1702
GABAAα4 (NM_000809) F AGACATCAAA GCCCCCTCAG 2044–2063 307
R GGAGAAGCAGATGGAAGTGC 2331–2350
GABAAα5 (NM_000810) F CGCTTTTACAACTGGGAAGATG 1657–1678 277
R GAGTGTGGCCGGTTATTTTG 1914-1933
GABAAα6 (NM_000811) F CCCACCCACA GTGACAATAT C 1367–1387 331
R TTCAACACTGCTACTGACTTCC 1676–1697
GABAAβ1 (NM_000812) F AATCCGGAATGAGACGAGTG 1493–1512 326
R GGAAC CATTAGAACAGAC CT CAG 1796–1818
GABAAβ2 (A28108) F TGCCAACAATGAGAAGATGC 1259–1278 401
R AGT GGGAGGC CAT GTTTTAG 1640–1659
GABAAβ3 (NM_000814) F GACCGTTCAAAGAGCGAAAG 1168-1187 233
R CGTAGATGGGTCTTCTTGTGC 1380-1400
GABAAγ1 (NM_173536) F TAAAGCCTCG ATGACTCCTG 1274–1293 311
R GACTTCTTTTGATTTTTGCTTATGG 1560-1583
GABAAγ2 (NM_000816) F TTTGTCAGCAACCGGAAAC 1433–1451 355
R C CATATCAGTAAAACCCATAC CTC 1764-1787
GABAAγ3 (NM_033223) F C CAAC CAC CAC GAAGAAGAC 1305–1324 397
R GCTCTTCACTCTTCACTCTGAGC 1679–1701
GABAAδ (NM_000815) F ATTT CAACGC CGACTAC AGG 1090–1109 300
R GGGCGTAAATGTCAATGGTG 1370–1389
GABAAε (NM_00496l) F GACAAAAG C C CAT G CTTCTC 1144-1163 255
R AAACGCTTGCACCACTCAC 1380–1398
GABAAπ (U95367) F GTTTGAGCTT CGGAGGAATG 861–880 201
R AAGCAGTTGGTGTTGGGAAG 1042–1061
GABAAθ(BD106470) F CCTCAGCCCACTCACTTCTC 1278-1297 297
R GCTTCTTGCACACCCTTCTC 1555-1574
GABABR1a (AJ012185) F CAACGC CACCTCAGAAG 69–85 234
R GAGCAGATTCGGACACAG 285-302
GABABR1a/b (AJ012186) F CTGAATCCTGCCAATACCC 937–955 256
R AGTTCATTGCCCGGTAGA 1175-1192
GABABR2 (AJ012188) F GACCATCTCAGGAAAGACTC 984–1003 235
R GGTCTCGTTCATGGCATT 1201-1218
GAD65 (NM_000818) F ATGC CT C CTACCT CTTT CAG 1406–1425 218
R CACCATCTCATATCCTTCTC 1604-1623
GAD67 (NM_000817) F ACTGGCTGAATACCTCTATG 2005–2024 318
R CCCAGT CTTT CTATCTCCTC 2303-2322
  F: forward; R: reverse