Skip to main content

Table 1 Real-time PCR primers

From: Glycolysis is essential for chemoresistance induced by transient receptor potential channel C5 in colorectal cancer

Gene Forward primer sequence (5′-3′) Reverse primer sequence (5′-3′)
TRPC5 CCACCAGCTATCAGATAAGG CGAAACAAGCCACTTATACC
GLUT1 CTTTGTGGCCTTCTTTGAAGT CCACACAGTTGCTCCACAT
β-actin GCCCTTGCTCCTTCCACTATC CCGGACTCTTCGTACTCATCCT