Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Primers used in qRT-PCR

From: Positive prognostic value of HER2-HER3 co-expression and p-mTOR in gastric cancer patients

Gene Forward primer (5′—3′) Reverse primer (5′—3′)
GAPDH GGTCACCAGGGCTGCTTTTA TTCCCGTTCTCAGCCTTGAC
HER-2 CCGAGGGCCGGTATACATTC GCTTGCTGCACTTCTCACAC
HER-3 CCCAGGTCTACGATGGGAAG AGAAGGAACCATCGGGAACT
AKT ACTGTCATCGAACGCACCTT CTCCTCCTCCTCCTGCTTCT
mTOR ACCCATCCAACCTGATGCTG ACACTGTCCTTGTGCTCTCG