Skip to main content

Advertisement

Table 1 Primers used in qRT-PCR

From: Positive prognostic value of HER2-HER3 co-expression and p-mTOR in gastric cancer patients

Gene Forward primer (5′—3′) Reverse primer (5′—3′)
GAPDH GGTCACCAGGGCTGCTTTTA TTCCCGTTCTCAGCCTTGAC
HER-2 CCGAGGGCCGGTATACATTC GCTTGCTGCACTTCTCACAC
HER-3 CCCAGGTCTACGATGGGAAG AGAAGGAACCATCGGGAACT
AKT ACTGTCATCGAACGCACCTT CTCCTCCTCCTCCTGCTTCT
mTOR ACCCATCCAACCTGATGCTG ACACTGTCCTTGTGCTCTCG