Skip to main content

Advertisement

Fig. 1 | BMC Cancer

Fig. 1

From: Decreased expression of the β2 integrin on tumor cells is associated with a reduction in liver metastasis of colorectal cancer in mice

Fig. 1

Analysis of the expression of β2-integrin on C26 and β2-C26 cells. Lysates of unmodified (wild type) and β2-depleted C26 cells were collected for RNA (a) and protein (b-c) expression levels. a For β2 integrin RNA analysis by RT-PCR the following primers were used: forward ATCCTGACCCCCAATGATGG, reverse 5’CGGATGGGTAGTCGAACTCA. GAPDH was used as an internal control (house keeping gene) (b) Protein lysates were obtained from 1 clone cell line clones as described in Material and methods. At the protein level, the β2 integrin was detected by Western Blotting applying specific antibodies recognizing the β2 subunit of the integrin. c Tumor cells were incubated in the presence of specific antibodies for the integrin β2. Then, cells were subjected to FACS analysis after incubation of Alexa-488 antibody. The black line represents C26 cells, the red line represents β2-C26 cells and dash line represents the negative control. d Protein lysates were obtained from a pool of stably transfected C26 (left). Additionally, protein lysates were obtained from C26 tumor cells transiently transfected either with a control siRNA or three siRNAs specific for β2 integrin (right). At the protein level, the β2 integrin was detected by Western Blotting applying specific antibodies recognizing the β2 subunit of the integrin

Back to article page