Fig. 1

Analysis of the expression of β₂-integrin on C26 and β₂-C26 cells. Lysates of unmodified (wild type) and β₂-depleted C26 cells were collected for RNA (a) and protein (b-c) expression levels. a For β₂ integrin RNA analysis by RT-PCR the following primers were used: forward ATCCTGACCCCCAATGATGG, reverse 5’CGGATGGGTAGTCGAACTCA. GAPDH was used as an internal control (house keeping gene) (b) Protein lysates were obtained from 1 clone cell line clones as described in Material and methods. At the protein level, the β₂ integrin was detected by Western Blotting applying specific antibodies recognizing the β₂ subunit of the integrin. c Tumor cells were incubated in the presence of specific antibodies for the integrin β_2. Then, cells were subjected to FACS analysis after incubation of Alexa-488 antibody. The black line represents C26 cells, the red line represents β₂-C26 cells and dash line represents the negative control. d Protein lysates were obtained from a pool of stably transfected C26 (left). Additionally, protein lysates were obtained from C26 tumor cells transiently transfected either with a control siRNA or three siRNAs specific for β₂ integrin (right). At the protein level, the β₂ integrin was detected by Western Blotting applying specific antibodies recognizing the β₂ subunit of the integrin