Skip to main content

Table 2 Sequences and properties of the primers used in the study

From: Oestrogen receptor beta isoform expression in sporadic colorectal cancer, familial adenomatous polyposis and progressive stages of colorectal cancer

Gene Primer 5′ - 3′ Amplicon
length (bp)
Transcript variants Encoded Isoforms
ESR2 F:AATTGACCACCCCGGCAAG 64 a, b, d, f, k and l ERβ1, ERβ2 and ERβ4
Primers 1 R: TTTCCCCTCATCCCTGTCCA
ESR2 F:GGCTAACCTCCTGATGCTCC 57 a and g ERβ1 and ERβ5
Primers 2 R: TCCATGCCCTTGTTACTCGC
ESR2 a F:TCTCCTCCCAGCAGCAATCC 154 b, l and k ERβ 2
Primers 3 R:GGTCACTGCTCCATCGTTGC
PUM1 F:CACAGACACCACCTCCTTCC 73   
  R:CCATTCGTGAGTCCTCCCAG   
EIF2B1 F:ACCTGTCTTCATCCTCCCCT 71   
  R:GCTGCTTTTCGCCTGCATC   
POP4 F:TTACCTGCTTTCCCGCTGAG 114   
  R:GGCTAGGAAGCTACAGCACC   
  1. bp: base pairs aThis primer sequence was obtained from ref. [22] F: forward; R: reverse