Skip to main content

Table 1 The primers of UGT1A/DPYD variants genotypes

From: Examination of multiple UGT1A and DPYD polymorphisms has limited ability to predict the toxicity and efficacy of metastatic colorectal cancer treated with irinotecan-based chemotherapy: a retrospective analysis

Mutation Type PCR Primer (5′-3′) Product length
UGT1A1*6 [5] Primer-F: ACGCCTCG TTGTACATCAGAG 217 bp
  Primer-R: CCTTGTT GTGCAGTAAGTGG  
UGT1A1*27 Primer-F: ACTTACTGCACAACAAGGAGCT 484 bp
  Primer-R: CACACCTGGGATAGTGGATTTTG  
UGT1A1*28 [5] Primer-F: AGCCAGTTCAACTGTTGTTGC 208 bp
  Primer-R: TTTGCT CCTGCCAGAGGTTC  
UGT1A7*2/*3/*4 [28] Primer-F: TTTGCCGATGCTCGCTGGACG 415 bp
  Primer-R: GCTATTTCTAAGACATTTTTGAAAAAATAGGG  
UGT1A9*22 [35] Primer-F: ACTTAACATTGCAGCACAGG 556 bp
  Primer-R: ATGGGCAAAAGCCTTGAACT  
DPYD*5 Primer-F: ATTCAGTTCACTGCTCACTGAC 370 bp
  Primer-R: GAGAAAGTTTTGGTGAGGGCA  
DPYD c.1896 T > C, Primer-F: TGGACAAAGCTCCTTTCTGAATA 231 bp
DPYD*2A [36] Primer-R: CAGCAAAGCAACTGGCAGAT