Skip to main content

Table 1 Primers sequences

From: GABPA predicts prognosis and inhibits metastasis of hepatocellular carcinoma

  Primer name F:5′-3′ R:5′-3’
RT-PCR GABPA AAGAACGCCTTGGGATACCCT GTGAGGTCTATATCGGTCATGCT
E-cadherin CGACCCAACCCAAGAATCTATC AGGTGGTCACTTGGTCTTTATTC
β-actin ATAGCACAGCCTGGATAGCAACGTAC CACCTTCTACAATGAGCTGCGTGTG
shRNA GABPA-1 CCGGTGTTATCAGTAAGAAGTTCTAGCTTCAAGAGAGCTAGAACTTCTTACTGATAATTTTTTG AATTCAAAAAATTATCAGTAAGAAGTTCTAGCTCTCTTGAAGCTAGAACTTCTTACTGATAACA
GABPA-2 CCGGTGATCTGGATCAATAACAACCTCTTCAAGAGAGAGGTTGTTATTGATCCAGATTTTTTTG AATTCAAAAAAATCTGGATCAATAACAACCTCTCTCTTGAAGAGGTTGTTATTGATCCAGATCA
E-cadherin GATCCGCACCAAAGTCACGCTGAATTTCAAGAGAATTCAGCGTGACTTTGGTGTTTTTTACGCGTG AATTCACGCGTAAAAAACACCAAAGTCACGCTGAATTCTCTTGAAATTCAGCGTGACTTTGGTGCG
Pbobi-cmv GABPA GACTCTAGAGGATCCATGTACCCATACGACGTCCCAGACTACGCTACTAAAAGAGAAGCAGAGGAGC AATTAATTCCTCGAGTTAATTATCCTTTTCCGTTTGCAGAGAAGC
ChIP RT-PCR E-Cadherin-P1 CAGTTGCTATGATGAGCCAAGA GGGAAGTCAGTGTTCTCCTTTG
E-Cadherin-P2 CTCTCATTGGCCTCAATCTCTC GCCACTGACCAGCTCATTTA
E-Cadherin-P3 ACCACGCCTGGCTAATTT GATCACGAGGTCAGGAGATTG
E-Cadherin-P4 CTCACTAACCCATGAAGCTCTAC GCCGAGGCTGATCTCAAAT
E-Cadherin-P5 CACCTGTACTCCCAGCTACTA GGTCTCACTCTTTCACCCAAG