Skip to main content

Table 2 Primers used in second round PCR amplification

From: Is detection of intraperitoneal exfoliated tumor cells after surgical resection of rectal cancer a prognostic factor of survival?

# Start (bp) End (bp) Template, fragment # from # from “Forwards” primer (5′ - 3′) “Reverse” primer (5′ - 3′) Annealing temperature (°C)
1 16,569 25 1 aTGCATGGAGAGCTCCCGTGAGTGG CCCCTTAAATAAGACATCACGAT 52
2 42 126 1 aATTAACCACTCACGGGAGCTCTC AGGATGAGGCAGGAATCAAAGAC 55
4 131 181 1 aCACCCTATGTCGCAGTATCTGTC CACACTTTAGTAAGTATGTTCGC 55
6 483 513 1 aGGGGTTAGCAGCGGTGTGTGTGTG TCCCACTCCCATACTACTAATCT 55
7 530 633 1 aTACCCAGCACACACACACCGCTG CAAACCTATTTGTTTATGGGGTGA 55
8 673 705 1 aTTAGAGGGTGAACTCACTGGAAC GGTTTGGTCCTAGCCTTTCTATT 58
82 7031 7134 10 aACGACACGTACTACGTTGTAGCC AATATGATAGTGAAATGGATTTT 52
84 7340 7416 10 aCTTTCTTCCCACAACACTTT CT C TCTCAAATCATGAAAATTATTAAT 55
125 11,029 11,086 16 aTTAGGAGGGGGGTTGTTAGGGGGT CATCCCTCTACTATTTTTTAACC 58
127 11,193 11,243 16 aACCAGCCAGAACGCCTGAACGCA GGTGTTGTGAGTGTAAATTAGT G 55
128 11,283 11,311 16 aTGTGCCTGCGTTCAGGCGTTCTGG TAATCATATTTTATATCTTCTTC 60
130 11,437 11,492 16 aTTGACCCAGCGATGGGGGCTTCGA GAGCCAACAACTTAATATGACTA 55
176 15,201 15,257 22 aAGAATCGTGTGAGGGTGGGACTGT AGTAATTACAAACTTACTATCCG 60
177 15,274 15,377 22 aAGTAGACAGTCCCACCCTCACAC GGTGATTTTATCGGAATGGGAGG 60
178 15,394 15,448 22 aCTAGGAATCACCTCCCATTCCGA TAATGTCATTAAGGAGAGAAGGAA 55
181 15,761 15,864 22 aACCTCCTCATTCTAACCTGAATC CAGGCCCATTTGAGTATTTTGTTT 55
184 16,080 16,130 23 aCAAGTATTGACTCACCCATCAAC ACAGGTGGTCAAGTATTTATGGTA 57
187 16,263 16,366 23 aAACTGCAACTCCAAAGCCACCCC CCCTATCTGAGGGGGGTCATCCAT 58
  1. a=tail sequence (CCCGCCGCCCCCGCCCGGG)
  2. GC-Clamp = (6FAM-GCGCCCGCCGCGCCCCGCGCCCGTCC CGCCGCCCCCGCCCGGG)