Skip to main content

Table 2 Primer sequences and conditions for MS-HRM analysis

From: Hypermethylation of CDKN2A exon 2 in tumor, tumor-adjacent and tumor-distant tissues from breast cancer patients

  Primer sequence Primer concentration [nM] Additional MgCl2 concentration [mM] Ta [°C]a Amplicon length [bp] No. of CpGsb LOD/LOQ [%] Reference
APC f: 5′ AAGTAGTTGTGTAATTCGTTGGAT 3′
r: 5′ CACCTCCATTCTATCTCCAATA 3′
500 - 53 149 10 0.4/1.4 [32]
BRCA1 f: 5′ TTGTTGTTTAGCGGTAGTTTTTTGGTT 3′
r: 5′ AACCTATCCCCCGTCCAAAAA 3′
250 2 61 122 9 0.4/1.6 [33]
CDKN2A f: 5′ CGGAGGAAGAAAGAGGAGGGGT 3′
r: 5′ CGCTACCTACTCTCCCCCTCT 3′
400 - 62 93 7 1.0/3.3 [34]
CDKN2A (exon 2) f: 5′ GGCGGAGTTGTTGTTGTTTTATG 3′
r: 5′ ACAACACCACCAACGTATCCAA 3′
250 1.5 52 116 10 3.5/10.7 In-house
[NG_007485.1]
ESR1 f: 5′ TTAAAGTTGGAGGTTCGGGAGT 3′
r: 5′ CTACCCCGAAAACCTACGAATC 3′
250 - 52 112 8 0.1/0.5 In-house
[NG_008493]
HER2/neu f: 5′ GGATTGGAGAAATTAGGGGAGT 3′
r: 5′ ACTCCGACTAAACCCGACTAAA 3′
250 2 52 137 15 0.4/1.4 In-house
[NG_007503.1]
LINE-1 f: 5′ TGTTAGATAGTGGGTGTAGGTT 3′
r: 5′ AAATACATCCGTCACCCCTTT 3′
250 - 57 139 9 11.7/22.3 In-house
[X58075.1]
PTEN f: 5′ TCGGTTGGGTTTTTGGGTAGAGG 3′
r: 5′ CGCAAACTCTACTAAACATACCCAATAT 3′
250 - 60 156 9 0.1/0.5 [35]
  1. f forward primer, r reverse primer, T a annealing temperature, bp base pairs, LOD limit of detection, LOQ limit of quantification
  2. aTouchdown in 1 °C increments in cycles 1-7
  3. bWithout CpGs in the primers