Skip to main content

Table 2 Characteristics of miRNA and snRNA Transcripts

From: Differential long-term stability of microRNAs and RNU6B snRNA in 12–20 year old archived formalin-fixed paraffin-embedded specimens

Transcript Sequence Length (nt) GC Content
hsa-miR-141 UAACACUGUCUGGUAAAGAUGG 22 40.90%
hsa-miR-21 UAGCUUAUCAGACUGAUGUUGA 22 36.40%
hsa-miR-221 AGCUACAUUGUCUGCUGGGUUUC 23 47.80%
RNU6B CTGCGCAAGGATGACACGCAAATTCGTGAAGCGTTCCATATTTTT 45 44.40%